Publicado por: Djalma Santos | 3 de maio de 2014

Transdução bacteriana

Embora as bactérias não apresentem reprodução sexuada típica, algumas espécies são capazes de promover recombinação genética, capaz de modificar seu genótipo. Essa recombinação consiste, em última análise, na interação de duas moléculas de DNA que são clivadas e religadas entre si, num arranjo diferente do que existia anteriormente.  Dessa forma, essa mistura de material genético leva à formação de indivíduos com características genéticas diferentes. Os indivíduos, assim modificados, podem se dividir, inúmeras vezes, por cissiparidade (bipartição ou divisão binária), forma assexuada de reprodução [ver PLASMÍDEOS (PLASMÍDEO F), matéria publicada neste blog em 04/06/2013]. A recombinação genética nas bactérias pode ocorrer, naturalmente, por três diferentes vias: transformação, transdução e conjugação, que lembram, dentro de certos limites, a reprodução sexuada. A análise desses processos, que se tornou disponível durante a década de 1950, forneceu, em função de serem a base do mapeamento genética, informações valiosas acerca dos genes bacterianos. Em todos os processos mencionados ocorre passagem de material genético de uma bactéria doadora para uma receptora que pode incorporar, por recombinação, o DNA recebido ao seu patrimônio genético. Em consequência, uma bactéria pode passar a revelar uma ou mais características que não possuía antes. Assim sendo, a recombinação, por quaisquer desses processos, mantém, nas bactérias, uma variabilidade genética que compensa a ausência da meiose e da fecundação, levando a que elas tenham maiores chances de se adaptar a ambientes diferentes. A engenharia genética ou tecnologia do DNA recombinante (ver CLONAGEM GÊNICA, matéria publicada neste blog em 26/02/2011) também promove recombinação genética nesses organismos. As mutações (ver MUTAÇÃO GÊNICA, matéria publicada neste blog no dia 15/04/2011), base do processo evolutivo, podem, igualmente, contribuir para a diversidade genética de uma população. Nesta publicação, veremos apenas a transdução bacteriana. A transformação bacteriana já foi abordada neste blog [ver TRANSFORMAÇÃO BACTERIANA, matéria publicada em 10/03/2014] e a conjugação será vista em outra oportunidade.

Transdução bacteriana é a transferência indireta e horizontal de segmentos da molécula de DNA de uma bactéria (doadora) para outra (receptora) por meio de um bacteriófago ou fago (vírus bacteriano), que funciona como um vetor. Isto ocorre (figura abaixo) quando se forma uma partícula viral dotada de uma pequena porção do “cromossomo” hóspede, presente na bactéria doadora, gerando um fago transdutor (fago defectivo). O DNA bacteriano é, em última análise, incorporado em uma partícula bacteriofágica durante sua montagem no hospedeiro infectado (doador). Uma vez liberados, durante a lise celular, os bacteriófagos transdutores podem transferir, para outra bactéria, os genes bacterianos que transportavam, injetando nela não apenas o seu material genético, mas também DNA da célula morta. Assim sendo, a bactéria infectada subsequentemente (receptora) pode incorporar em seu “cromossomo”, genes provenientes da cepa doadora, transportados pelo bacteriófago. Não sendo destruída, esta bactéria pode se multiplicar e originar uma linhagem portadora (transduzida) dessas novas características, obtidas de outras através do fago transdutor. Lembramos que os fagos defectivos embora ainda retenham, via de regra, a capacidade de injetar seu DNA na bactéria, podem ser incapazes de lisar a célula, não causando, portanto, a infecção propriamente dita. A transdução aqui descrita é denominada generalizada, que veremos adiante, em tipos básicos de transdução.

01

A transdução foi descoberta por Joshua Lederberg e Norton Zinder, em 1952 com Salmonella typhimurium. Eles misturaram duas linhagens auxotróficas desse organismo, uma chamada LA22 (com genótipo fen- trip- met+ his+) e outra denominada LA2 (fen+ trip+ met- his-) e obtiveram um pequeno número, cerca de 1 em cada 100 mil células,  de cepas prototróficas (fen+ trip+ met+ his+). Lembramos que cepas auxotróficas são incapazes de sintetizar determinadas moléculas como aminoácidos e vitaminas, sendo, portanto, deficientes nutricionais. As prototróficas, por outro lado, são capazes de crescer em meio constituído de sais e açúcares simples (meio mínimo), sem que haja necessidade da adição de nutrientes específicos. Uma melhor análise do processo mostrou que o contato entre as células não era necessário para a recombinação se processar, o que descartou a ocorrência de conjugação bacteriana. A explicação passou a ser baseada em um sistema familiar, a infecção por bacteriófago.

Há dois tipos básicos de transdução: a generalizada e a especializada (ou restrita).

I. Transdução generalizada: requer a ocorrência de um ciclo lítico, onde, eventualmente, pode haver inserção, no vírus, de fragmento de DNA da célula hospedeira, formando partículas transdutoras (defectivas), que correspondem ao capsídeo viral contendo DNA bacteriano em seu interior (figura abaixo). Esse fragmento poderá ser transferido, numa infecção subsequente, para outra bactéria, pois os processo de adsorção e injeção de DNA dependem, essencialmente, da estrutura do vírus, sendo independente, via de regra, do tipo de DNA contido em seu interior.

02

Na transdução generalizada qualquer gene pode, potencialmente, ser transferido para a linhagem receptora com a mesma probabilidade, ao contrário da transdução especializada, que transfere genes específicos. A frequência com que um determinado gene é transferido na transdução generalizada é muito baixa, uma vez que cada partícula transdutora leva apenas um determinado fragmento de DNA [apenas uma minoria da prole do fago (1 em 10.000) transporta genes doadores]. Nesta transdução, nucleases virais degradam o DNA do hospedeiro em pequenos pedaços, que sendo ocasionalmente e aleatoriamente empacotados na partícula do fago, através de um mecanismo denominado “head full” ou preenchimento da cabeça do fago, forma, como vimos anteriormente, uma partícula transdutora. A transdução generalizada tem sido extremamente útil e amplamente adotada para o mapeamento de genes bacterianos, processo que consiste na localização dos genes no cromossomo da bactéria.

II. Transdução especializada (ou restrita): este processo é dependente da ocorrência de um ciclo lisogênico dos fagos temperados, como o fago lambda da Escherichia coli, e se limita a alguns genes específicos, daí a denominação desse fenômeno. Esses fagos, cujo nome foi proposto por Elie Wollman, do Instituto Pasteur em Paris, numa referência a “O Cravo Temperado” de Johann Sebastian Bach, podem, ao contrário dos virulentos, integrar seu DNA ao DNA bacteriano. No estado integrado (estado reprimido), muito semelhante aos retrovírus endógenos em animais (ERVs), o genoma do bacteriófago é denominado profago (ou provírus) e a cepa que o possui é chamada bactéria lisogênica (geradora de lise ou ruptura). Os provírus podem, graças a um processo chamado indução, serem liberados no citoplasma, tornar-se ativo novamente e iniciar um ciclo lítico (ciclo reprodutivo), causando a lise da bactéria hospedeira [ver PLASMÍDEOS (EPISSOMO NÃO BACTERIANO), matéria publicada neste blog no dia 04/06/2012). Caso a excisão dos profagos ocorra de maneira defeituosa, poderá haver a transferência de um pequeno fragmento de DNA bacteriano para o DNA viral, ficando parte do DNA viral incorporada ao DNA bacteriano (figura abaixo). Apenas DNA hospedeiro de cada lado do local onde o provírus está inserido pode ser transferido, justificando a transdução especializada. Esses vírus defeituosos (defectivos) podem, a exemplo da transdução generalizada, transferir o DNA bacteriano para outras células, pois, como vimos acima, a  adsorção à parede bacteriana e a injeção de DNA na célula a ser infectada estão associadas, essencialmente, a estrutura viral.

03

Do exposto, pode-se concluir que a diferença crítica entre os dois tipos de transdução é que a generalizada envolve a transferência de pedaços aleatórios de DNA bacteriano e a especializada envolve apenas transferência de genes imediatamente adjacentes ao sítio de integração do profago.

Publicado por: Djalma Santos | 21 de abril de 2014

Testes de permeabilidade celular (1)

01. Leia os três trechos abaixo.

1. O transporte de substâncias através da membrana pode ocorrer sem gasto de energia pelo simples fato das partículas de soluto serem pequenas e terem afinidade com a membrana.

2. O transporte na membrana pode ocorrer sem gasto de energia, porém com o auxílio de uma proteína transportadora.
3. O transporte quando se desprende ATP para ser realizado.
Analise as afirmativas abaixo e assinale a opção correta.
a) O transporte citado por 1 é osmose.
b) O transporte em 2 tem como exemplo a bomba de sódio e potássio.
c) O 3 é a clasmocitose.
d) O 2 é difusão facilitada.
e) 1 é pinocitose e 2 é difusão simples.

02. A capacidade de passagem de substâncias como água para o interior da célula através da membrana sem “gasto” de energia denomina-se:
a) Osmose.
b) Clasmocitose.
c) Transporte ativo.
d) Endomitose.
e) Fagocitose.

03. (UERJ) Em um experimento realizado em um laboratório escolar, duas tiras de batata foram mergulhadas por 10 minutos, uma na solução A e a outra na solução B. Os resultados, após este tempo, estão resumidos na tabela adiante.

tab.

Em relação à tonicidade do citoplasma das células de batata, as soluções A e B são respectivamente classificadas como:

a) Hipotônica e isotônica.
b) Isotônica e hipertônica.
c) Hipertônica e hipotônica.
d) Hipotônica e hipertônica.
e) Hipertônica e isotônica.

04. (UEG)

04A membrana celular funciona como um fluido que permite a difusão de proteínas dentro de uma matriz lipídica. Esse mosaico fluido constitui uma barreira de permeabilidade seletiva indispensável para a fisiologia celular. A figura mostra as alterações que podem ocorrer em uma hemácia quando se modifica a concentração de NaCl no meio em que ela se encontra. Assinale a afirmativa correta para as diferentes concentrações de NaCl de acordo com a seqüência da morfologia das hemácias:

a) 0,6%, 0,9%, 1,5% e 2,0%.
b) 2,0%, 1,5%, 0,9% e 0,6%.
c) 2,0%, 1,5%, 0,6% e 0,0%.
d) 1,5%, 0,9%, 0,6% e 0,0%.
e) 0,0%, 1,5%, 2,0% e 2,5%.

05. (UEA-MODELO ENEM) As células vivas necessitam manter em seu interior certos tipos de moléculas e íons em concentrações diferentes das encontradas no meio externo. Por exemplo, nossas células precisam manter uma concentração interna de íons potássio cerca de dez vezes maior que a existente no meio extracelular. Por outro lado, a concentração de íons sódio no interior de nossas células deve ser mantida cerca de dez a quinze vezes mais baixa que fora da célula. Em condições normais, o mecanismo responsável pela manutenção da diferença de concentração desses íons dentro e fora da célula é:
a) A osmose.
b) O transporte ativo.
c) A endocitose.
d) A difusão simples.
e) O transporte passivo.

06. (UENP) Dado o diagrama de Höfler abaixo, assinale a alternativa verdadeira.

06

                                          Disponível em http://www.tudomaisumpouco.com/aulabio3.html

 a) A célula em turgidez completa apresenta a força de sucção interna (Si) maior que a força de resistência da parede celular (M) e, portanto, a célula se encontra com baixo volume de água.

b) A alta taxa osmótica é dada quando a célula se encontra num meio hipotônico, apresentando baixa força de sucção interna (Si) e baixa resistência da parede celular (M).

c) O diagrama de Höfler representa situação osmótica em células, como por exemplo, as hemácias no soro.
d) Quando a célula vegetal está murcha, significa que está num meio hipertônico.
e) A hemácia pode ser representada neste diagrama com turgidez completa, pois a força da membrana plasmática é resistente a altas pressões.

07. (UNIV.CATO.SC-MODELO ENEM) A agricultura está enfrentando um grande problema em todo o mundo com a falta de recursos hídricos adequado, forçando muitos produtores a utilizar água salobra para a irrigação das culturas (Reed, 1996). Em muitas áreas de produção, o uso de água de baixa qualidade para irrigação e a aplicação de quantidades excessivas de fertilizantes são as principais razões para o problema do aumento da salinidade do solo. Em se tratando de regiões áridas e semiáridas irrigadas, constitui um sério problema, limitando a produção agrícola e reduzindo a produtividade das culturas a níveis antieconômicos. Os efeitos da salinização sobre as plantas podem ser causados pelas dificuldades de absorção de água, toxicidade de íons específicos e pela interferência dos sais nos processos fisiológicos (efeitos indiretos) reduzindo o crescimento e o desenvolvimento das plantas.

Fonte<http://200.7.175.130/agroumsa/sites/default/files/repositorio/cap_09_

Efeitos%20dos%20sais%20no%20solo%20e%20na%20planta.pdf>Acesso em: 14/05/2013.

A aplicação de quantidades excessivas de fertilizantes são as principais razões para o problema do aumento da salinidade do solo. O aumento da salinidade do solo pode dificultar a planta na absorção de agua, uma vez que:

a) O solo se torna hipotônico em relação às raízes das plantas, ocorrendo perda de água por osmose.
b) O solo se torna hipertônico em relação às raízes das plantas, ocorrendo perda de água por osmose.
c) O solo se torna hipertônico em relação às raízes das plantas, ocorrendo perda de água por transporte ativo.
d) As plantas se tornam hipertônicas e perdem água por osmose.
e) As plantas se tornam hipotônicas e ganham água por osmose.

08. (UEPA)               Leia com atenção o texto a seguir para responder esta questão.
As sensações, sentimentos, pensamentos, respostas motoras e emocionais, a aprendizagem e a memória, resultam do processo de comunicação entre as células nervosas, os neurônios, que continuamente coletam informações sobre o estado interno do organismo e de seu ambiente externo. Essas células possuem a habilidade de processarem informações que controlam o fluxo de substâncias do meio intracelular (íons sódio, potássio, etc.) e realizam os processos de difusão e osmose em suas membranas.
Adaptado de http://www.cerebromente.org.br/n10/fundamentos/ pot2.htm
Segundo o texto, a comunicação entre essas células ocorre por meio de processo:
a) Passivo com desprendimento de energia como a difusão e a osmose.
b) Ativo sem desprendimento de energia como a bomba de sódio e potássio.
c) Passivo como a difusão, a osmose e a bomba de sódio e potássio.
d) Ativo como a bomba de sódio e potássio e processo passivo como a difusão e a osmose.
e) Ativo como a difusão e bomba de sódio e potássio e processo passivo como a osmose

09. (IFPE) Ao temperarmos uma salada de verduras, com sal e vinagre, muito tempo antes de consumi-la, observamos um acúmulo de água que é liberada pelos vegetais. Esse fenômeno:
a) Recebe o nome de osmose e ocorre porque o meio extracelular fica hipertônico em relação ao meio intracelular.
b) É chamado de osmose e ocorre porque o meio extracelular fica hipotônico em relação meio intracelular.
c) Recebe o nome de difusão simples e ocorre porque o meio intra e o extracelular se tornam isotônicos.
d) Tanto pode ser osmose como difusão simples, pois o meio extracelular pode se tornar hiper ou hipotônico em relação à célula.
e) O acúmulo de água verificado não tem nenhuma relação com a concentração dos meios intra e extracelular dos vegetais em questão.

10. (UEA-MODELO ENEM) Uma cultura de protozoários da mesma espécie e dotados de vacúolos pulsáteis foi dividida em quatro placas de Petri numeradas (1, 2, 3 e 4). Em seguida, adicionou-se 10 mL de água destilada na placa 1; 10mL de solução salina a 2% na placa 2; 10mL de solução salina a 4% na placa 3 e 10mL de solução salina a 10% na placa 4. Sob tais condições experimentais, é correto afirmar que haverá maior atividade dos vacúolos pulsáteis nos protozoários que estiverem nas placas:
a) 1 e 2.
b) 2 e 3.
c) 3 e 4.
d) 1 e 4.
e) 2 e 4.

11. (UNICENTRO) A membrana plasmática, que envolve todas as células, é de vital importância na manutenção da integridade celular. Outrora vista como uma entidade bastante estática que mantinha os limites celulares definidos e impedia o vazamento de seus conteúdos, a membrana plasmática é uma estrutura dinâmica que apresenta atividade e seletividade notáveis. É uma barreira de permeabilidade que separa o interior do ambiente externo à célula, regula o fluxo vital do tráfego molecular dentro e fora da célula e é responsável por muitas das propriedades funcionais das células especializadas. Com base nessa descrição, observe a figura a seguir.

11
(Adaptada de: <http://www.sobiologia.com.br/conteudos/Citologia/cito12.php&gt;.Acesso em: 6 set. 2013.)

Considerando os processos pelos quais uma substância pode atravessar a membrana celular, assinale a alternativa que descreve, corretamente, o processo representado pela figura.
a) Movimento de partículas de uma área de alta concentração para uma área de baixa concentração, tendendo as partículas a se espalharem devido a essa movimentação constante e casual.
b) Processo pelo qual energia é provida ao sistema transportador para mover moléculas em direção oposta a um gradiente de concentração, utilizando proteínas presentes na membrana plasmática como “bombas”.
c) Processo pelo qual um solvente se difunde através da membrana semipermeável das células, movendo-se no gradiente de concentração da área onde está mais concentrado para a área onde está mais diluído.
d) Transporte no qual proteínas presentes na membrana plasmática, as permeases, ajudam a difusão de uma molécula através da membrana, capturando a molécula da substância pela qual têm afinidade facilitando sua entrada na célula.

12. (PUC-RIO) O gráfico abaixo representa a entrada, sem gasto de energia, da substância “X” em uma célula, em função da concentração desta substância no meio externo.

12

Com base nesse gráfico, as curvas I e II representam, respectivamente, um processo de:
a) Transporte ativo e osmose.
b) Difusão facilitada e osmose.
c) Osmose e difusão facilitada.
d) Osmose e transporte ativo.
e) Transporte ativo e difusão facilitada

13. (UEM) Assinale o que for correto.
I II
0 0 – A membrana plasmática está presente em todas as células eucarióticas vivas.
1 1 – O mecanismo de transporte dos íons Na+ e K+ (bomba de sódio-potássio) é um processo ativo que opera tanto na membrana plasmática quanto na parede celular.
2 2 – Plasmodesmos são pontes citoplasmáticas que, em células vegetais e animais, atravessam a membrana plasmática, propiciando troca de substâncias entre células adjacentes.
3 3 – A parede celular impede a ruptura das células vegetais, se estas forem mergulhadas em água pura ou soluções hipotônicas.
4 4 – A membrana plasmática apresenta a propriedade chamada de permeabilidade seletiva. Assim, a dupla camada de lipídios é permeável a íons e impermeável a gases.

14. (FCM-PB) A Fibrose Cística caracteriza-se por abundante secreção de muco nas vias aéreas, que impedem ou dificultam a passagem do ar para os pulmões. Esta doença está relacionada com a ausência de uma proteína de membrana responsável pelo transporte de:
a) Íon Na.
b) Íon K.
c) Íon Mg.
d) Íon Ca.
e) Íon Cl.

15. (FPS) Assinale a alternativa em que constam apenas processos passivos de transporte através da membrana.
a) Difusão facilitada, osmose e bomba de Na+/K+.
b) Osmose, exocitose e difusão.
c) Fagocitose, exocitose e pinocitose.
d) Difusão, difusão facilitada e osmose.
e) Bomba de Na+/K+, fagocitose e osmose.

16. (INSTITUTO FEDERAL DE SÃO-MODELO ENEM) Uma espécie de alga unicelular foi colocada em um tubo de ensaio (I) contendo uma determinada solução salina e o seu volume vacuolar foi analisado. Após certo tempo, as algas foram transferidas para outro tubo de ensaio (II) e o seu volume vacuolar foi novamente analisado. E, em seguida, elas foram transferidas para outro tubo de ensaio (III) e repetiu-se a análise. As variações de volume foram ilustradas em um gráfico.

16

Pode-se concluir que os diferentes tubos de ensaio (I, II e III) continham, respectivamente, soluções:
a) Hipotônica, isotônica e hipertônica.
b) Hipertônica, hipotônica e isotônica.
c) Isotônica, hipertônica e hipotônica.
d) Isotônica, hipotônica e hipertônica.
e) Hipotônica, hipertônica e isotônica.

17. (UPF) Em contato com a água do mar, a maioria das células sofre plasmólise. Isso acontece porque a água marinha, em relacao ao conteudo celular, é uma solução:
a) Isotônica.
b) Hipotônica.
c) Hipertônica.
d) Hidropônica.

18. (IFTM-MODELO ENEM) Leia atentamente o modo de preparo da receita, a seguir:
Salada de tomate, alface e cenoura crua.
Ingredientes: 1 tomate
1 cenoura
1 pé de alface
Sal e azeite a gosto
Modo de preparo
1. Corte o tomate em pequenos pedaços, enrole as folhas de alface e corte em pedaços pequenos.
2. Rale a cenoura em tiras pequenas.
3. Misture os ingredientes e tempere com sal e azeite a gosto.
4. Se quiser pode utilizar o molho rosé, dá um toque especial.
In < http://tudogostoso.uol.com.br/receita/135577-salada-de-tomate-alface-e-cenoura-crua.html&gt; Acessado em 11 de Mai de 2013.
No modo de preparo é sugerido que se coloque sal na salada. Nos minutos seguintes à colocação de sal, as células vegetativas perdem água, formando um caldo no fundo da travessa. Este fenômeno físico é explicado como sendo:
a) Osmose, que é o deslocamento do solvente (água) do meio hipertônico (citosol) para o meio externo (hipotônico), a fim de alcançar a isotonia.
b) Osmose, que é o deslocamento do solvente (água) do meio hipotônico (citosol) para o meio externo (hipertônico), a fim de alcançar a isotonia.
c) Osmose, que é o deslocamento do soluto (sal) do meio hipotônico (citosol) para o meio externo (água), a fim de alcançar a isotonia.
d) Difusão facilitada, que é o deslocamento do solvente (sal) do meio hipertônico (citosol) para o meio externo (água), facilitando alcançar a isotonia.
e) Difusão, que é a passagem do soluto (sal) do meio hipotônico (citosol) para o meio externo, levando junto à água.

19. (UEM) Com relação aos mecanismos de permeabilidade celular, assinale o que for correto.
a) Denomina-se plasmólise o processo que ocorre quando uma célula é colocada em uma solução hipotônica.
b) O transporte ativo de sódio e potássio, através da membrana plasmática, não impõe um consumo de energia à célula.
c) Quando uma célula é colocada em solução hipotônica, ela perde água para o meio, sofrendo turgescência.
d) Denomina-se fagocitose o englobamento de partículas sólidas pela célula, comumente observada em células do sangue, como as hemácias.
e) Denomina-se clasmocitose o mecanismo que a célula utiliza para eliminar resíduos de seu interior para o meio extracelular.

20. (UFPR) A osmose exerce uma função fundamental nos vegetais, desde a absorção de água até os pontos mais altos das árvores com dezenas de metros, pela pressão osmótica, até a condução de substâncias por todo o organismo. O processo osmótico pode ser descrito pela equação da sucção celular:
Sc = Si – M
em que:
Sc (sucção celular total) = a capacidade de absorção de água por uma célula.
Si (sucção interna) = pressão osmótica do suco celular.
M = pressão da membrana celulósica.
Com base na equação, considere as seguintes afirmativas:
1. A célula está túrgida quando Sc = 0, porque Si e M se equivalem.
2. Quando a célula está plasmolisada, Sc equivale a Si, porque a parede não exerce pressão (M = 0).
3. Numa solução hipertônica, a célula torna-se túrgida, porque a pressão exercida pela membrana celulósica se contrapõe à pressão osmótica do suco celular (Si = M).
4. Numa solução hipotônica, a célula torna-se plasmolisada, porque a membrana celulósica deixa de exercer pressão sobre o citoplasma (Sc = Si).
Assinale a alternativa correta.
a) Somente as afirmativas 1 e 2 são verdadeiras.
b) Somente as afirmativas 3 e 4 são verdadeiras.
c) Somente as afirmativas 1, 2 e 4 são verdadeiras.
d) Somente as afirmativas 1 e 3 são verdadeiras.
e) As afirmativas 1, 2, 3 e 4 são verdadeiras.

21. (UNAMA) Ao temperarmos salada com sal, pimenta-do-reino, vinagre e azeite, depois de algum tempo percebemos que as células das folhas das verduras ficam murchas porque o meio em que elas se encontram é hipertônico. Esse fenômeno ocorre porque as células:
a) Receberam água do meio mais concentrado.
b) Perderam água para o meio mais concentrado.
c) Receberam água do meio menos concentrado.
d) Perderam água para o meio menos concentrado.

22. (UNAMA) As soluções hipertônicas estão em uso em algumas partes do mundo, apesar de objeções levantadas contra tal uso, em virtude de dados experimentais derivados de experimentos de hemorragia não controlada. Dentre essas soluções, a de NaCl a 7,5%, tem sido empregada no tratamento de diversas condições, incluindo trauma, choque hemorrágico, cardiogênico e séptico, e suporte volêmico intraoperatório de cirurgias de grande porte.
(Adaptado de http://www.redetec.org.br/inventabrasil/hiperhsd.htm. Acessado em 04.05.2011).
Sobre a referida solução, pode-se afirmar que:
a) Tem concentração maior que a dos glóbulos vermelhos do sangue.
b) Tem a mesma concentração dos glóbulos vermelhos do sangue.
c) Tem concentração menor que a dos glóbulos brancos do sangue.
d) Provoca entrada de água nas células sanguíneas.

23. (UECE) Em uma aula de Biologia Geral, o Professor mostrou, por meio de um experimento comparativo, que quando glóbulos vermelhos são colocados em uma solução hipotônica, podem se romper devido à excessiva entrada de água por osmose, mas quando o mesmo é feito com uma célula de origem vegetal, apesar de ficar túrgida, ela não se rompe. A estrutura responsável por esse resultado é denominada:
a) Membrana plasmática.
b) Parede celular.
c) Vacúolo vegetal.
d) Vacúolo contrátil.

24. (IFG-MODELO ENEM) O bacalhau, cuja carne é submetida ao processo de salgamento, para sua conservação, é um dos principais pratos da culinária portuguesa e também muito apreciado pelos brasileiros. Ele pode ser preparado de diversas formas, mas geralmente são colocadas batatas para deixar o prato menos salgado. Analise as afirmativas a seguir, a respeito do processo ocorrido durante o preparo do bacalhau.
I. O sal passa para a batata por difusão.
II. O sal passa para a batata por osmose.
III. O amido da batata se dissolve, adoçando o bacalhau.
IV. O sal passa para a batata por transporte ativo.
Está(ão) correta(s):
a) Somente a afirmativa I.
b) Somente a afirmativa II.
c) Somente a afirmativa III.
d) Somente as afirmativas I, II e III.
e) Somente as afirmativas II, III e IV.

25. (UFU) São poucas as células que realizam o transporte de substâncias por meio da fagocitose. As amebas (protozoários), por exemplo, utilizam esse processo em sua alimentação. Considerando esse tipo de transporte, analise as afirmativas abaixo.
I. Pela emissão de pseudópodes, a ameba captura o alimento, que é digerido no seu interior
por meio de enzimas específicas.
II. A fagocitose é um transporte ativo, pois o alimento atravessa a membrana com a ajuda de
proteínas que carregam o alimento para o interior da ameba.
III. Nos vertebrados, o processo de fagocitose é utilizado por algumas células de defesa, como
por exemplo, alguns glóbulos brancos.
Marque a alternativa correta.
a) Apenas I e III são corretas.
b) Apenas I e II são corretas.
c) Apenas II e III são corretas.
d) I, II e III são corretas.

26. (UFPel-MODELO ENEM) As células estão em constante troca com o meio ambiente, que pode ser em grandes quantidades de moléculas, como o caso da endocitose e exocitose.

26

Baseado nos textos e em seus conhecimentos é incorreto afirmar que:
a) A formação de vesículas ocorre, em todos os processos ilustrados. Nas figuras 1 e 2, as vesículas são formadas a partir da membrana plasmática, e, na figura 3, as vesículas são formadas no interior da célula.
b) A figura 2 ilustra um processo que, ao contrário do ilustrado na figura 1, é realizado por praticamente todos os tipos celulares no ser humano.
c) A figura 3 corresponde a um processo de eliminação de material intracelular, como por exemplo os hormônios.
d) A figura 1 corresponde ao processo de pinocitose, que é empregado por alguns protistas para a obtenção de alimentos.
e) As figuras 1 e 2 representam tipos de endocitose, um processo que permite a incorporação de material pela célula.

27. (UFSCar) O processo de salinização pode ocorrer em solos intensamente irrigados. Sais presentes na água de irrigação acumulam-se no solo quando a água evapora. Em algumas situações, plantas cultivadas podem passar a perder água pelas raízes, ao invés de absorvê-la. Quando isso ocorre, pode-se dizer que:
a) As células das raízes perdem água por osmose e tornam-se plasmolisadas.
b) As concentrações de soluto dentro e fora das células se igualam por transporte ativo de sais e as células tornam-se túrgidas.
c) As células das raízes perdem água para o meio externo mais concentrado, por difusão facilitada, e tornam-se lisadas.
d) As células das raízes perdem água para o meio externo menos concentrado, por osmose, e tornam-se lisadas.
e) As concentrações dos solutos dentro e fora das células se igualam por difusão facilitada da água e as células tornam-se plasmolisadas.

28. (IFTM-MODELO ENEM) O cafezinho servido em São Paulo, o chá mate do Rio de Janeiro, o Chimarrão do Rio Grande do Sul, os chás caseiros, são produtos que apresentam em comum, o modo de extração de compostos presentes nas matérias-primas empregadas nestas bebidas, em que se utiliza água quente. Marque a alternativa correta abaixo que represente o mecanismo físico dos movimentos dos solutos das partes vegetativas torradas para o solvente empregado nestes processos.
a) Osmose, na qual, o solvente se movimenta do meio hipotônico para o meio hipertônico visando a isotonia.
b) Difusão facilitada, que caracteriza pelo fato do soluto se movimentar do meio hipotônico para o meio hipertônico até ocorrer a isotonia.
c) Difusão simples, pois se caracteriza por se ter o movimento do soluto do meio hipertônico para o meio hipotônico.
d) Bomba, pois envolve participação de energia química com dissipação de temperatura no mecanismo de extração.
e) Ativação Enzimática, pois a temperatura alta da água provoca aumento da velocidade das enzimas antes inativas nos tecidos vegetativos.

29. (IFNMG) Em relação aos mecanismos de transporte através da membrana, julgue as proposições abaixo:
I. O transporte passivo refere-se à passagem de substâncias do interior da célula para o meio externo.
II. O transporte ativo refere-se à passagem de substâncias do meio externo para o interior da célula.
III. O transporte osmótico pode promover tanto a entrada quanto a saída de água na célula.
Marque a alternativa correta:
a) As afirmativas I e II estão corretas.
b) Somente a afirmativa II está correta.
c) Somente a afirmativa III está correta.
d) Todas as afirmativas estão corretas.

30. (IFBA-MODELO ENEM) Você conhece a regra dos 5 segundos? Aquela que diz que, se você derrubar comida no chão e pegar de volta, antes de completar 5 segundos, você pode comer em segurança? Bom, se você usa essa regra como lei fundamental na sua vida, é melhor começar a rever seus conceitos, caro leitor. Um recente estudo da Universidade Metropolitana de Manchester decidiu alertar os gulosos que mantêm essa prática. Os resultados provaram que alimentos com alto teor de sal ou açúcar, como a maioria dos processados, têm menos chance de pegar bactérias em um período de tempo tão curto. O presunto (com alto teor de sal), o pão doce e a geleia foram considerados seguros, com poucos indícios de bactérias, depois de retirados do chão após três segundos. O alto teor de açúcar da geleia tornou a fatia de pão um terreno ruim para a proliferação de bactérias.
Disponível em:: http://revistagalileu.globo.com. Acesso em 20 de junho de 2012.
Em relação ao texto, foram feitas as seguintes afirmativas:
I. O alto teor de açúcar na geleia torna a fatia de pão um meio hipertônico em relação às bactérias, que são hipotônicas.
II. O processo de transporte através da membrana do qual o texto trata é a bomba de sódio-potássio
III. O mesmo princípio aplicado à conservação do presunto pode ser adequado para se conservar alguns tipos de carne fora da geladeira.
Deve-se concluir que:
a) Somente a I e II estão corretas.
b) Somente a II e III estão corretas.
c) Somente a III é correta.
d) Somente I e III estão corretas.
e) Somente a II está correta.

31. (UFG-MODELO ENEM) Leia o texto a seguir.
A criação de peixes ósseos de água doce para fins comerciais impõe aos animais estresses decorrentes do manejo de rotina e doenças ocasionadas por protozoários. Para reduzir o aparecimento dessas doenças utiliza-se banhos com solução de NaCl, em concentrações entre 2 a 5% com tempo de exposição variando entre 20 segundos a 20 minutos.
KUBITZA, Fernando. A versatilidade do sal na piscicultura. Panorama da aquicultura, set./out. 2007. p. 14-23. (Adaptado).
De acordo com o texto, o controle de protozoários requer a utilização de solução salina em concentração superior à fisiológica. Portanto, para que o banho salino não cause a morte dos animais, ele deve ser breve o suficiente para impedir que os peixes:
a) Inchem por absorção excessiva de água.
b) Desidratem por perda excessiva de água.
c) Inchem por ingestão de solução salina.
d) Inchem por retenção de urina concentrada.
e) Desidratem por excreção de urina concentrada.

32. (UFRR) Em células vegetais, quando o ambiente é hipotônico em relação ao vacúolo, este ganha água e incha. O volume da célula aumenta, então dizemos que ocorreu turgescência. Com isso, entra a ação de duas forças, das quais uma delas exercida tende a encher o vacúolo.
a) Pressão de sucção interna.
b) Pressão de turgescência.
c) Plasmólise.
d) Pressão de difusão.
e) Difusão facilitada.

33. (IFNMG) Analisando as células vegetais a seguir, podemos perceber que, de acordo com o meio em que ela se encontra, esta irá sofrer alterações na quantidade de água que entra e que sai. Esse fenômeno é conhecido como osmose e está relacionado à diferença de soluto de um meio para o outro.

33

De acordo com as figuras e o assunto abordado, analise as alternativas abaixo e assinale a que apresentar uma informação correta:
a) Na figura 2, a célula está em um meio hipotônico.
b) Na figura 3, a célula está em um meio hipertônico.
c) Na figura 1, a célula está em um meio hipertônico.
d) Na figura 2, a célula está em um meio hipertônico.

34. (PUC-CAMPINAS-MODELO ENEM) Para responder esta questão considere o texto abaixo.
A primeira vista, parece pedra jogada na praia ou madeira boiando no mar. Mas a secreção serosa formada nas entranhas do cachalote é quase tão valiosa quanto o ouro. Enquanto cada grama do metal é vendido a US$ 30, o âmbar-cinza está cotado a US$ 20. No organismo da baleia, a missão dessa substância pastosa é envolver as partes duras das lulas – que ela não consegue digerir – protegendo seu intestino de ferimentos.
Quando expelida pela baleia, tem cheiro de esterco, endurece e ganha aroma especial despois de flutuar por décadas no oceano. O cheiro, então, passa a lembrar a castanha-do-brasil ou a madeira de igrejas antigas. Assim como o sal ressalta o sabor, ele intensifica odores e fixa aromas.
(Adaptado: Revista Gelileu, n. 248, 2012. P. 13)
Além de ressaltar o sabor, o sal está entre os primeiros métodos usados pelo homem para a conservação dos alimentos. O principal efeito da adição de sal é:
a) Inibir a ação das enzimas dos alimentos.
b) Intoxicar os fungos e as leveduras.
c) Desnaturar as enzimas das bactérias.
c) Alterar o pH do alimento.
e) Desidratar os alimentos por osmose.

35. (UFTM-MODELO ENEM) Durante uma aula prática, os alunos colocaram algumas hemácias humanas em água destilada e analisaram a variação do volume celular. Após o experimento, as variações no volume das células foram indicadas em um gráfico. Sabendo-se que as hemácias humanas ficam mergulhadas no plasma sanguíneo, cuja solução apresenta 0,9% de NaCl, o gráfico que ilustra corretamente a variação do volume das hemácias na água destilada, em função do tempo, está indicado em:

35

36. (UFPA) Numerosos exemplos de atividade de transporte pela membrana são vistos durante a atividade fisiológica dos rins. Por exemplo: o HCO3 formado intracelularmente é devolvido por difusão para a circulação sistêmica por um transportador Cl-/HCO3, na região basolateral da célula renal, enquanto o H+ entra no lúmen do túbulo renal por uma das duas bombas de prótons apicais, H+/ATPase ou H+-K+/ATPase. Sobre os solutos transportados e seus transportadores e estas atividades direcionadas através da membrana plasmática da célula renal, é correto afirmar:
a) O transporte direcionado de HCO3 e de H+ na membrana plasmática da célula renal consome ATP.
b) H+/ATPase é uma bomba iônica de atuação similar à Na+-K+/ATPase, e ambas atuam a favor do gradiente de concentração dos solutos.
c) O transportador Cl-/HCO3 regula a alcalose metabólica por transporte ativo.
d) A difusão do HCO3 pela membrana da célula ocorre a favor do gradiente de concentração do soluto.

37. (UESC-MODELO ENEM) O esquema abaixo ilustra um experimento em que se compara o comportamento de células animais e vegetais em soluções com diferentes concentrações.

37

A análise desse experimento permite afirmar que:
a) Células vegetais modificam intensamente a forma da parede celular quando são colocadas em ambientes com gradiente de concentração.
b) Representa um exemplo de transporte passivo porque envolve uma tendência ao equilíbrio iônico sem “gasto” de energia na forma de ATP.
c) O tipo de transporte caracterizado é o ativo porque o deslocamento do solvente é a favor do gradiente de concentração.
d) A osmose em células animais se caracteriza pelo deslocamento de soluto de um ambiente hipertônico para um ambiente hipotônico.
e) Tanto as células vegetais quanto as células animais murcham ao serem imersas em um ambiente hipotônico.

38. (SENAC-SP) Uma célula animal foi mergulhada em uma solução aquosa de concentração desconhecida. As alterações ocorridas na célula estão representadas no gráfico abaixo.

38

A tonicidade relativa da solução e o tipo de fenômeno que explica os resultados são, respectivamente:
a) Hipotônica e difusão.
b) Hipotônica e osmose.
c) Isotônica e osmose.
d) Hipertônica e difusão.
e) Hipertônica e osmose.

39. (UEPG) As figuras abaixo representam o resultado de uma célula vegetal colocada em soluções de diferentes concentrações. Com base nas figuras, assinale a alternativa correta.

39

Fonte: Amabis, J.M.; Martho, G.R. Biologia das Células.
2a ed. Volume 1. Editora Moderna. São Paulo. 2004.
a) Na figura C, pode-se observar que a célula encontrasse em um meio menos concentrado (hipotônico) e perde água por osmose.
b) A água que entra por osmose na célula vegetal (condição representada pela figura A) faz com que ela inche até um ponto em que causa o rompimento da parede celular.
c) Na condição representada pela figura A, a célula encontra-se em um meio hipotônico e, nessa condição, diz-se que a célula ficou túrgida.
d) A célula na condição da figura B é denominada de plasmolisada, pois a mesma foi colocada em um meio isotônico, que poderia ser representado por água pura.
e) Uma célula colocada em um meio hipertônico tende a se expandir, pois a entrada de água e sais por transporte ativo faz com que a mesma torne-se túrgida (condição da figura C).

40. (FUVEST-MODELO ENEM) A porcentagem em massa de sais no sangue é de aproximadamente 0,9%. Em um experimento, alguns glóbulos vermelhos de uma amostra de sangue foram coletados e separados em três grupos. Foram preparadas três soluções, identificadas por X, Y e Z, cada qual com uma diferente concentração salina. A cada uma dessas soluções foi adicionado um grupo de glóbulos vermelhos. Para cada solução, acompanhou-se, ao longo do tempo, o volume de um glóbulo vermelho, como mostra o gráfico.

40

Com base nos resultados desse experimento, é correto afirmar que:
a) A porcentagem em massa de sal, na solução Z, é menor do que 0,9%.
b) A porcentagem em massa de sal é maior na solução Y do que na solução X.
c) A solução Y e a água destilada são isotônicas.
d) A solução X e o sangue são isotônicos.
e) A adição de mais sal à solução Z fará com que ela e a solução X fiquem isotônicas.

41. (PUC-RIO) Quando comemos em um restaurante, as saladas de alface que são servidas não contêm, em geral, sal ou nenhum tipo de condimento. As saladas são temperadas apenas na hora de comer. Esse procedimento evita que a salada murche rapidamente, pois, quando adicionamos sal e outros condimentos à salada:
a) O meio externo torna-se hipotônico, e as células da alface ficam túrgidas.
b) O meio externo torna-se isotônico, e as células da alface ficam túrgidas.
c) O meio externo torna-se hipertônico, e as células da alface sofrem plasmólise.
d) O meio externo torna-se hipertônico, e as células da alface sofrem lise celular.
e) O meio externo torna-se isotônico, e as células da alface sofrem lise celular.

42. (UPE) Observe a tirinha a seguir:

42

Nela Calvin faz alusão a uma ameba. Observe as afirmativas, a seguir, relacionadas a esse organismo e sua forma de alimentação ou locomoção por meio de pseudópodes e assinale a afirmativa correta.
a) A difusão facilitada ocorre a favor do gradiente de concentração, mas depende da ação dos pseudópodes da membrana plasmática para a entrada de glicose com gasto de energia.
b) A fagocitose é o englobamento de moléculas grandes ou sólidas por meio de expansões da membrana plasmática, denominadas pseudópodes.
c) A pinocitose é a captura de moléculas menores ou líquidas mediante a de invaginação da parede celular por meio de pseudópodes.
d) O glicocálix é um revestimento externo da membrana plasmática, formado por celulose e lipídios que irão desempenhar funções imunogênica e locomotora por meio de pseudópodes.
e) Os pseudópodes mantêm uma diferença de potencial entre os meios extra e intracelular, permitindo a locomoção sem gasto de energia.

43. (UEA) O desenho abaixo mostra uma célula vegetal que foi mergulhada em uma solução salina cuja concentração era menor que o meio intracelular. Após certo tempo, a célula ganhou água, havendo um aumento significativo do volume vacuolar.

43

O fenômeno que ocorreu e o nome do estado final em que a célula se encontra são, respectivamente:
a) Osmose e célula túrgida.
b) Transporte ativo e célula plasmolisada.
c) Transporte ativo e célula túrgida.
d) Transporte facilitado e célula plasmolisada.
e) Osmose e célula plasmolisada.

44. (UEG) Uma célula animal foi mergulhada em uma solução salina que apresenta cloreto de sódio e cloreto de potássio como soluto. Observou-se que a água deslocou-se da célula para o meio externo. Considerando-se o processo descrito e as partículas envolvidas, pode-se inferir o seguinte:
a) A face interna da membrana manteve-se com cargas positivas.
b) A solução salina é mais concentrada do que o interior da célula.
c) O sódio apresenta maior raio atômico que o potássio.
d) Os sais que formam são derivados de um ácido forte e base fraca.

45. (UCS) Para entender as propriedades da membrana celular e o processo de osmose, um biólogo realizou o experimento descrito a seguir. Três conjuntos de hemácias foram expostos a três diferentes soluções, conforme descrito abaixo.
A. O primeiro conjunto foi exposto a uma solução isotônica em relação ao líquido intracelular das hemácias.
B. O segundo conjunto foi exposto a uma solução hipotônica em relação ao líquido intracelular das hemácias.
C. O terceiro conjunto foi exposto a uma solução hipertônica em relação ao líquido intracelular das hemácias.
Assinale a alternativa correta, que corresponde aos resultados desse experimento.
a) As hemácias mantêm sua forma e seu volume, pois são impermeáveis à água.
b) As hemácias mantêm sua forma e seu volume somente quando expostas à solução hipertônica.
c) As hemácias murcham quando expostas à solução isotônica.
d) As hemácias incham quando expostas à solução hipotônica.
e) As hemácias incham quando expostas à solução isotônica.

46. (FUVEST) A figura abaixo representa uma célula de uma planta jovem.

46a

Considere duas situações:
1. A célula mergulhada numa solução hipertônica.
2. A célula mergulhada numa solução hipotônica.
Dentre as figuras numeradas de I a III, quais representam o aspecto da célula, respectivamente, nas situações 1 e 2?

46b

a) I e II.
b) I e III.
c) II e I.
d) III e I.
e) III e II.

47. (UEA-MODELO ENEM) O tucunaré é um dos mais apreciados peixes da fauna ictiológica da Amazônia. A carne branca e um tanto seca é realçada pela gordura em algumas partes do corpo, o que acaba por torná-la tenra e de sabor inigualável, tanto ao forno, frita ou na caldeirada. Pode-se comê-la também no tucupi, cozida com jambu. De qualquer forma é um verdadeiro requinte da culinária da região.
(www.portalamazonia.globo.com)
O tucunaré é hipertônico em relação ao hábitat em que vive, então, para estar em equilíbrio osmótico nesse meio, ele:
a) Ganha íons constantemente por transporte ativo do meio que o rodeia, cujo excesso será eliminado pelas brânquias.
b) Ganha água constantemente por osmose do meio, cujo excesso será eliminado por difusão facilitada através dos rins.
c) Perde água para o meio por osmose, que será reposta por osmose através das brânquias, já que produz reduzido volume urinário.
d) Não gasta energia com mecanismo de homeostasia hidrossalina, já que armazena grande quantidade de ureia no sangue, assim fica em equilíbrio o com o meio.
e) Ganha água por osmose e perde íons através da urina, os íons são repostos com gasto de energia por meio das brânquias.

48. (IFSC) Uma célula troca substâncias constantemente. O gás oxigênio, os aminoácidos e a glicose entram na célula ao mesmo tempo em que são eliminadas substâncias produzidas em seu interior, como o gás carbônico e compostos nitrogenados. Observe a figura abaixo e assinale a alternativa correta sobre processos de transporte de substâncias:

48

a) Os processos de transporte por difusão e osmose acontecem de forma passiva, portanto consomem energia para acontecer.
b) Na figura acima, o solvente irá passar do meio menos concentrado para o meio mais concentrado. Desta forma, a célula absorverá água.
c) A célula representada na figura acima perderá água por difusão até sofrer lise celular.
d) O processo de difusão está relacionado ao movimento ativo do solvente, enquanto o processo de osmose está relacionado ao movimento ativo do soluto.
e) O soluto representado poderia ser o oxigênio e este continuaria entrando na célula por um processo de difusão facilitada com “gasto” energético.

49. (UEA-MODELO ENEM) Em uma aula de biologia, a professora trabalhou com dois aquários, um com água do mar e alguns exemplares de camarões marinhos, e outro com água de rio e alguns exemplares de camarões capturados nesse ambiente. A professora questionou os alunos sobre o que ocorreria com o equilíbrio hidrossalino nas células dos camarões se alguns deles fossem transferidos de um aquário para o outro. Sobre o experimento, é correto afirmar que:
a) Tanto os camarões de água doce quanto os de água salgada, se trocados de aquário, irão equilibrar a concentração osmótica de suas células em relação ao meio no qual serão colocados, e se nele permanecerem sobreviverão sem problemas.
b) Os camarões de água doce, se colocados em água salgada, nada sofrerão, pois suas células têm concentração osmótica superior à da água onde normalmente vivem e, portanto, estarão em um meio isotônico, em relação à concentração osmótica de suas células.
c) Os camarões de água doce, se colocados em água salgada, não serão capazes de equilibrar a concentração osmótica de suas células em relação ao meio, e se nele permanecerem poderão morrer por perda de água para o meio no qual foram colocados.
d) Os camarões de água salgada, se colocados em água doce, nada sofrerão, pois suas células têm concentração osmótica inferior à da água onde normalmente vivem e, portanto, estarão em meio isotônico em relação à concentração osmótica de suas células.
e) Os camarões de água salgada, se colocados em água doce, nada sofrerão, pois suas células têm concentração osmótica superior à do meio onde serão colocados, e desse modo não perderão água de suas células para o meio.

50. (UFSC) Com relação ao transporte através da membrana plasmática, assinale a alternativa correta.
a) A membrana celular é muito permeável à água. Colocadas em uma solução hipertônica, as células aumentam de volume devido à penetração de água.
b) O Na+ é o íon positivamente carregado (cátion) mais abundante do lado de dentro da célula, enquanto o K+ é o mais abundante do lado de fora da célula.
c) Moléculas apolares tais como o oxigênio molecular e o dióxido de carbono não conseguem passar pela bicamada lipídica da membrana e por isso necessitam de proteínas especiais chamadas de carreadoras.
d) Numerosas substâncias, como a glicose e alguns aminoácidos, penetram nas células por difusão facilitada, sem gasto de energia. Neste caso, a difusão se processa a favor de um gradiente, porém em velocidade maior do que a difusão passiva.
e) As proteínas carreadoras permitem aos solutos atravessar a membrana a taxas muito mais rápidas que as proteínas-canal.

gab

 

Publicado por: Djalma Santos | 14 de abril de 2014

Testes sobre cadeias e teias alimentares (1)

01. (UEPG)A figura abaixo representa a teia alimentar em um lago (as bactérias, os seres do fitoplâncton e do zooplâncton e o gafanhoto estão ampliados em relação aos demais organismos). Com relação aos seus conhecimentos de teia alimentar, as relações de competição e o fluxo de energia, assinale o que for correto.

01

Fonte: Linhares, S.; Gewandsznajder, F. Biologia hoje, genética,

evolução e ecologia. Volume 3. Editora Ática. São Paulo. 2010.

I   II

0  0 – Na figura, o peixe maior se alimenta de outros peixes (consumidor terciário). Se houver um excesso populacional do peixe de tamanho maior, não haverá influência sobre o tamanho das populações de tamanho menor.

1  1 – Nesse exemplo, imaginando agora que o lago fosse extremamente poluído, não haveria ou haveria escassez de fitoplâncton, sem esses não haveria ou haveria escassez de consumidores primários, sem consumidores primários ou com a escassez destes faltaria recurso alimentar para os consumidores secundários, e assim sucessivamente. Esse é um bom exemplo da influência de um nível trófico sobre a ocorrência dos demais níveis de organização trófica.

2 2 – Nos ambientes aquáticos, os principais produtores são os seres autotróficos que constituem o fitoplâncton.

3  3 – O zooplâncton também corresponde ao nível trófico de produtores.

4  4 – Nessa organização, pode-se dizer que as aves são os animais que recebem a maior quantidade de energia de todos os níveis tróficos.

02. A figura representa uma cadeia alimentar em uma lagoa. As setas indicam o sentido do fluxo de energia entre os componentes dos níveis tróficos.

02

Sabendo-se que o mercúrio se acumula nos tecidos vivos, que componente dessa cadeia alimentar apresentará maior teor de mercúrio no organismo se nessa lagoa ocorrer um derramamento desse metal?

a) As aves, pois são os predadores do topo dessa cadeia e acumulam mercúrio incorporado pelos componentes dos demais elos.

b) Os caramujos, pois se alimentam das raízes das plantas, que acumulam maior quantidade de metal.

c) Os grandes peixes, pois acumulam o mercúrio presente nas plantas e nos peixes pequenos.

d) Os pequenos peixes, pois acumulam maior quantidade de mercúrio, já que se alimentam das plantas contaminadas.

e) As plantas aquáticas, pois absorvem grande quantidade de mercúrio da água através de suas raízes e folhas.

03. A ema (Rhea americana), que habita campos e cerrados do Brasil até o Uruguai, e o avestruz (Struthio camelus), que habita savanas na África, são espécies afins que vivem em ambientes muito parecidos e que têm hábito alimentar onívoro. No esquema de uma cadeia trófica com quatro níveis tróficos, a ema pode inserir-se:

a) Apenas no segundo nível.

b) Apenas no terceiro nível.

c) Apenas no primeiro e no segundo nível.

d) Apenas no terceiro e no quarto nível.

e) Apenas no segundo, no terceiro e no quarto nível.

04.

Festa da Natureza

“(…)

Com a força dessa água nova

O peixe e o sapo na desova

O camaleão que se renova

O verde-cana, que cor!

(…)

Entre a mata verdejante

Seu pajé extravagante

O gavião assartante

Que corre atrás da juriti

(…)”

 (Compositores: Patativa do Assaré/Gereba)

Na cadeia alimentar presente no trecho da música faltou mencionar:

a) O produtor.

b) Consumidor de 1ª ordem.

c) Consumidor de 2ª ordem.

d) Consumidor de 3ª ordem.

e) Decompositor.

05. (UFSC) O diagrama abaixo representa uma possível teia alimentar marinha antártica.

05

Com base nas informações contidas no diagrama, bem como em conceitos ecológicos, indique a soma da(s) proposição(ões) correta(s).

I   II

0  0 – O fitoplâncton configura o grupo dos produtores e os seres que se alimentam dele são consumidores secundários.

1  1 – As baleias com dentes participam de três níveis tróficos diferentes.

2 2 – Cerca de 10% da energia armazenada na matéria orgânica de cada nível trófico é convertida em matéria orgânica no nível trófico seguinte. Este fato é considerado relevante para a inexistência de cadeias alimentares muito longas.

3  3 – Os decompositores, não representados na teia alimentar acima, têm papel fundamental na ciclagem de nutrientes.

4  4 – O krill e a lula podem ser consumidores secundários ou terciários.

06. (FEI) A maior quantidade de energia numa cadeia alimentar é encontrada nível dos:

a) Produtores.

b) Consumidores primários.

c) Consumidores secundários.

d) Consumidores terciários.

e) Consumidores terciários e quaternários.

07.  (FGV-MODELO ENEM) Na goiabeira do quintal de uma casa, eram muitas as goiabas que se apresentavam infestadas por larvas de moscas. Nos galhos da árvore, inúmeros pássaros se alimentavam dos frutos enquanto, ao pé da goiabeira, pássaros iguais aos dos galhos se alimentavam das larvas expostas pelas goiabas que haviam caído e se esborrachado no chão. Pode-se  afirmar que:

a) Os pássaros dos galhos e os pássaros do chão ocupam diferentes níveis tróficos e, portanto, a despeito da mesma aparência, não pertencem à mesma espécie.

b) As larvas são decompositores, enquanto os pássaros são consumidores primários.

c) As larvas são consumidores primários e os pássaros podem se comportar como consumidores primários e secundários.

d) A goiabeira é produtor, os pássaros são consumidores primários e as larvas são parasitas, não fazendo parte de esta cadeia alimentar.

e) As larvas ocupam o primeiro nível trófico, os pássaros dos galhos e os pássaros do chão ocupam, respectivamente, o segundo e o terceiro níveis tróficos.

08. (UNIOESTE) Relativo a cadeias e teias alimentares, é correto afirmar que:

I   II

0  0 – a transferência de energia no ecossistema é unidirecional.

1 1 – a produtividade primária é a quantidade de matéria orgânica produzida pelos consumidores primários.

2  2 – um ecossistema é fechado com relação à energia e aberto com relação à matéria.

3 3 – a eliminação de um dos componentes da teia alimentar não causa desequilíbrio na cadeia.

4 4 – um decompositor age somente sobre os consumidores (primários, secundários e terciários), e não sobre os produtores.

09. (FATEC) O esquema abaixo representa as relações tróficas de uma comunidade.

09

Competem pelo mesmo tipo de alimento:

a) Coelhos, cobras e corujas.

b) Coelhos, camundongos e capivaras.

c) Cachorros-do-mato, onças e corujas.

d) Camundongos, onças e cobras.

e) Cachorros-do-mato, coelhos e capivaras.

10.  (UEPA-MODELO ENEM) As imagens e ilustrações são formas de comunicação muito antigas. Em uma caverna foram encontrados desenhos rupestres que ilustravam um grupo de homens caçando um animal semelhante a um bovino, em seguida se alimentavam desse animal num campo de capim onde outros animais, iguais à espécie capturada pelos homens, pastavam, enquanto algumas carcaças de animais mortos se encontravam no solo, às proximidades do grupo de homens. Quanto aos elementos descritos na ilustração mencionada afirma-se que:

a) Os homens são carnívoros e pertencem ao nível trófico dos consumidores primários.

b) Os animais semelhantes a bovinos são herbívoros e, por isso, são consumidores secundários.

c) O capim pertence ao nível trófico dos consumidores porque consome energia solar.

d) O capim é autótrofo e, por isso, pertence ao nível trófico dos produtores.

e) As carcaças estão sofrendo a ação de consumidores secundários.

11. (UEA-MODELO ENEM) O gráfico apresenta dados sobre a demanda bioquímica de oxigênio (DBO) e a concentração de metilmercúrio na água em cinco trechos (1, 2, 3, 4 e 5) ao longo de um rio.

11Ao compararmos os trechos 1 e 5 podemos afirmar corretamente que a quantidade de matéria orgânica em decomposição será:

a) Maior no trecho 1, onde os peixes do topo da cadeia alimentar terão a menor quantidade de metilmercúrio/kg do que os outros animais.

b) Menor no trecho 5, onde os produtores apresentarão maior quantidade de metilmercúrio/kg em comparação aos demais níveis tróficos.

c) Maior no trecho 1, onde os peixes dos níveis tróficos mais próximos dos produtores terão a maior quantidade de metilmercúrio/kg do que os animais mais distantes.

d) Menor no trecho 5, onde os peixes do topo da cadeia alimentar terão a maior quantidade de metilmercúrio/kg do que os outros animais.

e) Maior no trecho 5, onde os peixes do topo da cadeia alimentar terão a maior quantidade de metilmercúrio/kg do que os outros animais.

12. (IFPR-MODELO ENEM) O DDT (Dicloro-Difenil-Tricloroetano) é um eficiente matador de insetos. Introduzido em grande escala durante a segunda guerra mundial, foi muito utilizado na agricultura brasileira para o controle de insetos considerados como pragas. O DDT é um inseticida sintético que conserva sua atividade química por muito tempo, ao invés de se decompor com facilidade. Por esse motivo, é um inseticida persistente, conforme demonstra a figura abaixo:

12

Conforme o texto e a figura assinale a alternativa correta:

a) Na cadeia alimentar representada pela figura, os consumidores sustentam os produtores.

b) O padrão de acumulação do DDT é diferente do fluxo de energia em uma cadeia alimentar. A energia é armazenada, e não transmitida de um nível trófico para outro.

c) A concentração do DDT tende a aumentar no sentido dos produtores para os consumidores. Entre os consumidores, o acúmulo de DDT tende a ser maior em consumidores terciários do que em secundários.

d) A figura demonstra que a concentração de DDT diminui ao longo da cadeia, reduzindo sua concentração de modo que, nas plantas, atinge níveis muito baixos.

e) As plantas deveriam ocupar o topo da figura, enquanto os carnívoros ocupariam os níveis mais baixos da pirâmide.

13. (UFRN) O esquema abaixo ilustra uma teia alimentar composta por várias cadeias alimentares entre organismos de uma comunidade.

13

Com relação aos seus componentes e seus respectivos níveis tróficos nas cadeias alimentares distintas dessa teia alimentar, é correto afirmar que:

a) A cobra poderá ser consumidor secundário ou terciário.

b) O pardal, em qualquer cadeia alimentar, será um consumidor primário.

c) A coruja é um consumidor quaternário em qualquer cadeia alimentar.

d) O gavião, quando se alimentar do pardal, será um consumidor quaternário.

14. Considere as afirmações abaixo.

I. A fonte de energia para os seres vivos é o sol.

II. A energia é captada primariamente pelos produtores e transferida para os demais níveis tróficos.

III. A quantidade de energia transferida de um nível trófico para outro é sempre menor.

IV. Como a energia não pode ser destruída, as perdas são armazenadas na forma de petróleo.

Sobre elas, devemos dizer que:

a) Todas estão corretas.

b) Somente I, II e III estão corretas.

c) Somente II, III e IV estão corretas.

d) Somente II e IV estão corretas.

e) Somente II e III estão corretas.

15. (UEM) Baseando-se no esquema abaixo, assinale o que for correto.

15I   II

0  0 – Os herbívoros e os carnívoros das cadeias alimentares de um ecossistema ocupam o mesmo habitat e o mesmo nicho ecológico.

1  1 – A amônia resultante da decomposição de carboidratos pode ser transformada em nitrato, através de bactérias quimiossintetizantes desnitrificantes.

2 2 – Os decompositores são organismos heterótrofos que degradam matéria orgânica, liberando elementos minerais e outras substâncias para o ambiente.

3  3 – Todos os carnívoros da cadeia alimentar são predadores.

4 4 – A eliminação – quase que totalmente – das espécies de herbívoros pode provocar o aumento da população de carnívoros.

16. (IFG) A respeito das cadeias tróficas (alimentares), assinale a alternativa incorreta:

a) Em termos energéticos é mais vantajoso se comportar como consumidor terciário do que como consumidor primário.

b) O fluxo de energia em uma cadeia se dá de forma unidirecional, a partir dos produtores para os consumidores.

c) Em uma cadeia alimentar, além da transferência de matéria, também ocorre a transferência de energia.

d) A fonte primária de energia em uma cadeia alimentar provém do sol.

e) A maior parte da energia obtida pelos consumidores primários na alimentação não estará disponível para os consumidores secundários que se alimentarem deles.

17. Dois tipos de organismos garantem o equilíbrio de uma teia ecológica; sem eles, não haveria entrada de energia e o retorno dos nutrientes sob forma de matéria-prima. Esses organismos são, respectivamente:

a) Consumidores primários e secundários.

b) Produtores e consumidores primários.

c) Consumidores secundários e primários.

d) Produtores e decompositores.

e) Decompositores e consumidores de primeira ordem.

18. (UFF-MODELO ENEM) Ao deixarem de ser nômades, caçadores e coletores, os humanos se estabeleceram em áreas determinadas e começaram a cultivar plantas. Nesse processo, as paisagens naturais foram modificadas, sendo retirada a cobertura vegetal original para dar lugar às plantas cultivadas. Ao mesmo tempo, começou-se a domesticar animais, dentre estes, os gatos. Estudos paleontológicos recentes mostraram que os felinos se aproximavam atraídos por roedores, dentre estes, os ratos, que por sua vez eram atraídos pelos grãos que eram colhidos e armazenados. Aponte o gráfico que melhor representa o fluxo de energia da interação entre grãos, ratos e gatos.

18

19. (UFVJM) Em um ecossistema havia uma população de produtores, uma de consumidores primários e outra de consumidores secundários. Por interferência humana, a população de produtores foi dizimada. Com base no exposto assinale a alternativa que apresenta a consequência para as outras populações.

a) Os consumidores secundários não sofrerão impacto algum, já que são carnívoros.

b) Os consumidores primários diminuirão drasticamente, podendo ser extintos da região.

c) Os consumidores secundários serão beneficiados, pois seus predadores abandonarão a região.

d) Os consumidores primários, representados por fungos e bactérias, não sofrerão nenhuma interferência.

20. (UEM) Considerando os conceitos básicos de ecologia e a teia alimentar esquematizada a seguir, assinale a alternativa incorreta.

20a) Na teia alimentar, estão envolvidos organismos produtores e organismos consumidores.

b) Os insetos constituem os consumidores primários.

c) Os pássaros são predadores de insetos e de aranhas.

d) As aranhas e os pássaros são consumidores secundários.

e) A introdução de uma espécie que se alimenta de pássaros não afetará as populações de insetos e de aranhas.

21. (UFMS)O estudo das transferências de energia entre seresvivos é de grande importância para a humanidade,uma vez que o homem toma parte em diversas cadeiasalimentares.Levando em consideração seus conhecimentos sobreprodutividade e transferência de energia, assinale a(s)alternativa(s) correta(s).

I   II

0  0 – Em um ecossistema, o fluxo de energia é unidirecional e acíclico, ou seja, diferentemente do que ocorre com a matéria orgânica, não há reaproveitamento energético.

1  1 – A produtividade primária bruta corresponde ao total de energia luminosa efetivamente captada pelos autótrofos, ou seja, a quantidade de energia que uma planta consegue converter em biomassa, em determinado intervalo de tempo.

2  2 – Para as populações humanas, é muito mais vantajoso consumir carne de porco ou de gado alimentados com soja do que comer a soja.

3  3 – A produtividade primária líquida corresponde à energia armazenada na biomassa dos produtores, em um determinado intervalo de tempo, e que realmente está disponível para o nível trófico seguinte.

4  4 – Uma cadeia alimentar, com maior número de níveis tróficos, terá menores perdas energéticas, uma vez que os maiores ganhos de energia ocorrem na transferência de um nível para outro.

22. (FCMSC) Em cada transferência de energia de um organismo para outro ou de um nível trófico para outro, uma grande parte da energia é degradada em calor, de acordo com a segunda lei da Termodinâmica. Com esse conceito firmado, complete corretamente a frase seguinte:

Quanto _____ a cadeia alimentar ou quanto _____ estiver o organismo do _____ de uma cadeia alimentar, _____ será a energia disponível.

a) mais longa, mais próximo, fim, menor

b) mais longa, mais próximo, início, maior

c) mais curta, mais próximo, fim, menor

d) mais curta, mais próximo, início, menor

e) mais curta, mais próximo, fim, maior

23. (UFR) A cidade de Seropédica, onde está a Universidade Rural, recebeu esse nome devido ao grande desenvolvimento da sericicultura na região há muito tempo atrás. As larvas do bicho-da-seda Bombyx mori, produtoras da seda, atacavam as folhas da amoreira, comuns na região. Sob o ponto de vista ecológico, um predador dessas larvas se comporta como:

a) Produtor.

b) Decompositor.

c) Consumidor primário.

d) Consumidor secundário.

e) Consumidor terciário.

24. (UEM)A corvina é um peixe carnívoro encontrado na costa brasileira que se alimenta de crustáceos, de moluscos e de pequenos peixes. Assim, considerando uma cadeia alimentar com esses organismos, assinale a alternativa correta.

a) A corvina é um consumidor primário.

b) Os pequenos peixes estão no mesmo nível trófico das corvinas.

c) Crustáceos e moluscos são decompositores.

d) Crustáceos, moluscos e pequenos peixes são produtores.

e) O enunciado não menciona organismos produtores.

25. (UFSC) Ao analisarmos o ecossistema marinho, é correto afirmar que:

a) Os seres do zooplâncton são os consumidores secundários e, obrigatoriamente, ocupam o segundo nível trófico da cadeia alimentar.

b) Um mesmo ser não pode pertencer a diferentes níveis tróficos em um determinado ecossistema, já que sua posição na cadeia alimentar é sempre a mesma.

c) No fitoplâncton estão os principais produtores no ecossistema marinho, constituindo o primeiro nível trófico da cadeia alimentar.

d) A transferência de matéria e energia ocorre de forma cíclica nos ecossistemas, sem perdas ao longo da cadeia alimentar.

e) O fluxo de matéria e energia em um ecossistema é exclusivamente unidirecional.

26. (UFMT) Leia as afirmativas abaixo:

I. A energia introduzida no ecossistema sob a forma de luz é transformada, passando de organismo para organismo sob a forma de energia química,

lI. No fluxo energético, há perda de energia em cada elo da cadeia alimentar.

III. A transferência de energia na cadeia alimentar é unidirecional, tendo início pela ação dos decompositores.

IV. A energia química armazenada nos compostos orgânicos dos seus produtores é transferida para os demais componentes da cadeia e permanece estável.

Estão corretas as afirmativas:

a) I e II.

b) II e III.

c) III e IV.

d) I e III.

e) II e IV.

27. (FATEC) Um agricultor, desprezando as orientações de um tecnólogo em agronegócio, resolveu aplicar um pesticida em alta concentração em sua plantação, com a intenção de eliminar totalmente uma população de gafanhotos que vinha atacando sua lavoura. Considere que outras espécies também ocorrem nessa região e que essas interagem de acordo com a teia alimentar apresentada.

27

Espera-se que, com a remoção dos gafanhotos, ao longo do tempo,

a) Não ocorra qualquer impacto sobre a população de roedores.

b) Nenhuma das populações de consumidores terciários seja afetada.

c) Somente as populações de consumidores secundários sejam afetadas.

d) Ocorra uma diminuição no número de indivíduos na população de cobras.

e) Somente os produtores sejam afetados, com um aumento no número de indivíduos.

28. (UFPR) Ecossistema é um complexo sistema de relações mútuas, com transferência de energia e de matéria entre o meio abiótico e os seres vivos de determinada região. Com relação a essa definição, assinale a(s) alternativa(s) correta(s).

I   II

0 0 – Os elementos bióticos de um ecossistema podem ser classificados em produtores, consumidores e decompositores.

1  1 – Os elementos produtores são autótrofos, isto é, produzem a matéria orgânica necessária para sua manutenção a partir de substâncias inorgânicas.

2  2 – Os elementos  decompositores são microrganismos  que decompõem os restos de outros seres, restituindo compostos orgânicos ao meio ambiente.

3   3 – Os elementos consumidores  são heterótrofos, isto é, não produzem matéria orgânica a partir de substâncias inorgânicas, obtendo-a dos organismos que já a possuem.

4  4 – Os animais carnívoros ou herbívoros são decompositores porque, alimentando-se de outros seres, os destroem.

29. (UERN) O esquema a seguir representa uma:

29

a) Teia alimentar, em que a serpente ocupa três níveis tróficos.

b) Cadeia alimentar, em que a coruja se apresenta como consumidor secundário ao comer o lagarto.

c) Teia alimentar, em que a serpente comporta-se somente como consumidor terciário e quaternário.

d) Cadeia alimentar, em que existem dois consumidores primários e quatro consumidores secundários.

30. (CEFET-PR) Em uma floresta nativa há uma espécie de aranha que se alimenta de dípteros. Estes sugam seiva das plantas. Aranhas e dípteros constituem alimentos de um sapo verde que lá vive, e este por sua vez é eventualmente predado por cobras. Assinale a alternativa incorreta.

a) A cobra ocupa dois níveis tróficos na cadeia proposta.

b) O sapo ocupa mais de uma ordem como consumidor.

c) O díptero está no segundo nível trófico.

d) A planta está no primeiro nível trófico.

31. (ESAL-MG) Os animais herbívoros ocupam:

a) Apenas um habitat e um nível trófico.

b) Apenas um habitat e ou um nível trófico.

c) Apenas um habitat e vários níveis tróficos.

d) Vários hábitats e vários níveis tróficos.

e) Vários hábitats e apenas um nível trófico.

32. (PUC-SP) Em uma lagoa de água doce, são encontrados organismos como microcrustáceos (I), que se alimentam de fitoplâncton (II) e são animais predados por insetos aquáticos (III) e também por peixes pequenos (IV). Os insetos, por sua vez, servem de alimento para peixes maiores (V). Através da atividade de certas bactérias (VI) presentes no lago, substâncias orgânicas são degradadas e seus produtos, liberados no ambiente, podem ser reutilizados por outros organismos. Na tabela abaixo, que letra apresenta correspondência com a descrição?

tabela2

33. (FURRN) Quando um trabalhador nordestino, em tempo de fartura, alimenta-se de feijão, farinha de mandioca e rapadura, está ocupando, no ecossistema, o nicho ecológico de um:

a) Decompositor.

b) Produtor.

c) Consumidor secundário.

d) Parasita.

e) Consumidor primário.

34. (U. CATÓLICA DE SALVADOR) Considere o esquema abaixo, onde estão representadas interações alimentares de uma comunidade:

34

Assinale a alternativa que indica espécies competidoras.

a) Vegetais, coelhos e cobras.

b) Veados, coelhos e camundongos.

c) Cobras, onças e camundongos.

d) Veados e cachorros-do-mato.

e) Cachorros-do-mato e onças.

35. (COVEST) Tomando como referência as inter-relações entre os seres vivos e o ambiente físico, analise as seguintes proposições:

I    II

0   0 – os seres autótrofos armazenam energia e são chamados produtores.

1   1 – um animal só pode pertencer a uma cadeia alimentar.

2  2 – uma cadeia alimentar constitui-se pela sucessão em que um ser vivo serve de alimento para outro.

3  3 – quando um ser vivo se  alimenta diretamente de um produtor, é chamado consumidor primário.

4  4 – a teia alimentar é formada pelas diversas redes alimentares de um animal.

36. (UFSCar-SP) O esquema abaixo representa uma teia alimentar de uma lagoa. Sabendo que as setas indicam o sentido presa-predador, nessa teia a ave comporta-se como:

36a) Ictiófaga, consumidora de 2ae de 4 a ordens.

b) Ictiófaga, consumidora de 3 a e de 5 a ordens.

c) Coprófaga, consumidora de 3 a e de 5 a ordens.

d) Ornitófaga, consumidora de 2 a e de 4 a ordens.

e) Ornitófaga, consumidora de 3 a e de 5 a ordens.

37. (COVEST) Analise a figura abaixo e identifique a alternativa incorreta em relação à mesma.

37

a) A figura mostra uma sequência de indivíduos em que cada um serve de alimento àquele que o sucede e se alimenta daquele que o precede.

b) As setas 1, 2 e 3 indicam o fluxo da energia captada pelos vegetais através da fotossíntese, e transferida para os outros componentes da cadeia.

c) A seta 4 indica que toda a matéria orgânica morta é utilizada, na natureza, pelos decompositores que a transformam em matéria mineral.

d) A seta 2 mostra a passagem da energia de um consumidor de 1ª ordem para outro de 2ª ordem.

e) A seta 3 representa o fluxo de energia para o consumidor final da cadeia, que recebe maior quantidade de energia vindo do elo anterior que todos os demais componentes.

38. (CESGRANRIO) Na natureza, as bactérias crescem em condições muito diversas. Em certos casos, proliferam em fontes de água mineral, com ou sem a presença de luz, e realizam todas as sínteses necessárias a sua vida. Em muitos outros casos, crescem à custa de tecidos vegetais e animais mortos, utilizando proteínas, carboidratos e lipídios, que, em última análise, vão ser transformados em água, gás carbônico, sais de amônia e outros derivados minerais. Tais observações permitem classificar as bactérias como:

a) Produtores e decompositores.

b) Produtores e consumidores de 1a ordem.

c) Produtores e consumidores de 1a e 2a ordens.

d) Consumidores de 1a, 2a e 3a ordens.

e) Consumidores e decompositores.

39. (VUNESP) Considere um ecossistema representado por um campo. Nesse ecossistema, existem plantas, como o capim, gafanhotos que se alimentam do capim e pássaros que se alimentam dos gafanhotos. No solo, existem bactérias e fungos, que utilizam como alimento o capim e os gafanhotos e pássaros mortos. É correto afirmar-se sobre esse ecossistema que:

a) O capim pertence ao nível trófico dos consumidores primários.

b) Os gafanhotos devem ser mais abundantes do que os pássaros.

c) Os pássaros devem ser mais abundantes do que os gafanhotos.

d) Os fungos e bactérias representam os produtores.

e) Os vegetais representam a base da cadeia alimentar, pois ao respirarem absorvem gás carbônico e liberam oxigênio.

40. (FUVEST) O homem estará ocupando o nível trófico em que há maior aproveitamento de energia fixada pelos produtores, quando escolher como cardápio:

a) Carne com creme de leite.

b) Peixe com camarão.

c) Frango com toucinho.

d) Pão com geleia de frutas.

e) Ovos com queijo.

 

gaba2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Publicado por: Djalma Santos | 8 de abril de 2014

Testes de fotossíntese (1)

01. (FATEC) Observe o gráfico a seguir, que representa a taxa de fotossíntese líquida em relação à variação de alguns fatores ambientais.

01

De acordo com a figura, foram feitas quatro afirmações:

I. Para uma mesma temperatura, a taxa fotossintética líquida é maior à medida que aumenta a intensidade luminosa.

II. Para uma mesma intensidade luminosa, a taxa fotossintética é maior à medida que aumenta a temperatura.

III. Para uma mesma porcentagem de CO2 no ar, temperatura e luminosidade não influenciam a taxa fotossintética.

IV. O ponto de inflexão de cada curva representa o ponto de saturação de gás carbônico.

Estão corretas as afirmações contidas apenas em:

a) I e II.

b) III e IV.

c) I, II e III.

d) I, II e IV.

e) II, III e IV.

02.  (UCB) Fotossíntese é um processo físico-químico, a nível celular, realizado pelos seres vivos clorofilados, que utilizam dióxido de carbono e água, para obtenção de glicose por meio da energia da luz. No que se refere ao processo de fotossíntese, julgue os itens a seguir.

I    II

0  0  – Uma parte do açúcar se junta com a água e origina a seiva orgânica, a qual é distribuída para todas as partes da planta por meio de um sistema de vasos de condução chamado floema.

1  1 – A fotossíntese ocorre em duas grandes etapas, que envolvem várias reações químicas: a primeira é a fase clara (também chamada de fotoquímica) e a segunda é a fase escura (também conhecida como fase química).

2  2 – Plantas jovens consomem menos dióxido de carbono e libertam mais oxigênio, pois o carbono é incorporado a sua estrutura física durante o crescimento.

3  3 – A fotossíntese é o principal processo de transformação de energia na biosfera. Ao alimentar-nos, parte das substâncias orgânicas, produzidas graças à fotossíntese, entra na nossa constituição celular, enquanto outras (os nutrientes energéticos fornecem a energia necessária às nossas funções vitais, como o crescimento e a reprodução.

4  4 – A fase escura ocorre apenas à noite ou na ausência de luz.

03.  (PUCCAMP) Analise a seguinte afirmação: “Se as usinas elétricas utilizam madeira em lugar de combustíveis fósseis e se novas árvores são plantadas constantemente para substituir as que foram queimadas nas usinas, não há liberação de dióxido de carbono adicional”.

Considere:
x = volume de CO2 absorvido na fotossíntese realizada pelas plantas do reflorestamento, no tempo t
y = volume de CO2 eliminado na respiração das plantas do reflorestamento, no tempo t
z = volume de CO2 eliminado na combustão da madeira usada nas usinas elétricas, no tempo t
A afirmação só é válida se:
a) x = z.

b) x = y.

c) y = z.

d) z = xy.

e) z = x + y.

04. (IFB) As figuras abaixo se referem ao sistema fotossintético do vegetal representado por uma folha sob duas situações ambientais.

04

A interpretação dessas figuras que esquematicamente destacam aspectos relacionados ao processo da fotossíntese envolve reconhecer que:

a) A energia solar incidente é convertida em energia química potencializada na estrutura molecular da glicose.

b) O CO2 absorvido, principalmente nos estômatos, é decomposto com desprendimento do oxigênio e fixação do carbono.

c) O CO2 que é eliminado da planta principalmente durante a noite resulta da oxidação de moléculas orgânicas, e é simultaneamente utilizado na fotossíntese.

d) A clorofila atua como molécula que é sensível à energia solar e é mais eficiente na absorção das radiações que são percebidas como luz verde.

e) A produtividade primária da fotossíntese é, em sua maior parte, convertida em celulose, principal reserva da planta.

05.  (UFLA) Considere as seguintes etapas da fotossíntese:

I. Síntese de ATP.

II. Fotólise da água.

III. Síntese de glicose.

IV. Fixação do CO2.

Assinale a alternativa que apresenta a ordem correta das etapas da fotossíntese.

a) IIIIIIIV.

b) II IIIIIV.

c) IVIIIIII.

d) II IIVIII.

06. (ACAFE) O gás carbônico necessário para a realização da fotossíntese vegetal penetra nas folhas através de estruturas denominadas estômatos (do grego stoma, boca). A abertura e o fechamento dos estômatos dependem de diversos fatores, principalmente da luminosidade, da concentração de gás carbônico e do suprimento hídrico. A respeito do comportamento dos estômatos, assinale a alternativa correta que completa as lacunas da frase a seguir.

Os estômatos tendem a fechar quando a intensidade luminosa é __________, ou a concentração de CO2 no mesófilo foliar é __________. Ao contrário, eles tendem a abrir quando o suprimento de água nas raízes é _________.

a) alta – baixa – baixo.

b) baixa – baixa – alto.

c) baixa – alta – alto.

d) alta – alta – baixo.

07. (FATEC) Em determinada intensidade luminosa, conhecida como ponto de compensação fótico, as taxas de fotossíntese e de respiração de uma planta se equivalem, isto é, todo o oxigênio liberado na fotossíntese é utilizado na respiração, e todo o gás carbônico produzido na respiração é utilizado na fotossíntese. Assim, espera-se que uma planta submetida a uma intensidade luminosa correspondente ao seu ponto de compensação fótico:

a) Acumule maior quantidade de matéria orgânica e cresça normalmente.

b) Modifique periodicamente sua taxa de fotossíntese e de respiração, a fim de garantir sua perfeita floração e frutificação.

c) Apresente os pigmentos de clorofila saturados.

d) Não cresça, pois consome todo o alimento que produz.

e) Não cresça, pois absorve quantidades insuficientes de água e sais minerais do solo.

08. (IFMG) Respiração celular e fotossíntese são fenômenos distintos. Analise o gráfico que representa as taxas de respiração e fotossíntese de uma planta e assinale a alternativa correta:

08

Disponível em: < http://www.expoente.com.br/vestibular/&gt;.

Acesso em: 26 nov. 2012.

a) A representa a fase de maior acúmulo de matéria orgânica na planta, que poderá ser disponibilizada para os níveis tróficos dos consumidores.

b) Em A, a quantidade de gás carbônico consumido na fotossíntese é maior que a quantidade de gás carbônico produzido na respiração.

c) Em B, a quantidade de gás oxigênio liberado é igual à quantidade consumida.

d) Em C, o aumento da intensidade luminosa aumenta proporcionalmente a taxa de fotossíntese.

09. (FEI) No século XX, o cientista belga van Niel propôs que a fotossíntese bacteriana poderia ser representada de forma sucinta a partir da equação abaixo:

09

Para as sulfobactérias, que realizam um tipo especial de fotossíntese denominado fotorredução ou fotossíntese bacteriana, a letra X da equação acima pode ser corretamente substituída por qual dos elementos químicos a seguir?

a) O.

b) C.

c) S.

d) Cl.

e) N.

10. (ACAFE) A vida na Terra depende, em última análise, da energia proveniente do sol. A fotossíntese é um processo biológico que pode aproveitar essa energia. Sobre o tema é correto afirmar, exceto:

a) As reações dependentes de luz ocorrem na membrana dos tilacoides e as reações independentes de luz ocorrem no estroma do cloroplasto, sendo também fundamental a presença de luz para que seja mantido um pH alcalino e ocorra a ativação da enzima Rubisco na etapa de carboxilação da fotossíntese.

b) Plantas C3 e C4 não diferem nas etapas da fotossíntese, mas apresentam especificidades em relação aos fatores limitantes água, nutrientes e luz.

c) O ATP e o NADPH2 produzidos na fase dependente de luz são utilizados na fase independente de luz, no Ciclo de Calvin, para a síntese de carboidrato a partir do CO2.

d) Na fase dependente de luz a água é oxidada, com a liberação de gás oxigênio para o meio e os prótons e elétrons de hidrogênio contribuem para o potencial eletroquímico que irá operar na formação de ATP e NADPH2.

11. (UNICENTRO) Leia o texto a seguir.

Luz do sol

que a folha traga e traduz

Em verde novo,

Em folha, em graça,

Em vida, em força, em luz…

(Adaptado de: VELOSO, C. Luz do Sol.)

O texto refere-se a um processo pelo qual seres autotróficos utilizam gás carbônico, água e energia da luz do sol para fabricar açúcares, com liberação de oxigênio. Com relação a esse processo, assinale a alternativa correta.

a) A glicose é quebrada em duas moléculas de ácido pirúvico, gerando quatro moléculas de ATP e fornecendo duas para a produção de frutose-1,6-difosfato.

b) Consiste em oxidações sucessivas por meio da retirada dos átomos de hidrogênio ligados aos carbonos e de moléculas de gás carbônico.

c) Na fase clara desse processo, as moléculas de clorofila absorvem a energia da luz e a utilizam para sintetizar ATP bem como NADPH.

d) Na fase escura desse processo, ocorre oxidação pelo NAD, produzindo ácido succínico com quatro carbonos, NADH e CO2.

e) O processo começa com a acetil-CoA, condensando com o ácido oxalacético, com quatro carbonos para formar ácido cítrico com seis carbonos.

12. (UFCE) Relativo ao processo fotossintético, indique a(s) alternativa(s) correta(s):

I   II

0  0 – A fotossíntese tem como  objetivo a síntese de  compostos ricos em energia.

1  1 – As reações de claro da fotossíntese ocorrem nas zonas clorofiladas dos cloroplastos.

2  2 – A fase de escuro do  processo fotossintético  está na dependência dos produtos da fase de claro.

3  3 – Nas plantas, um dos compostos fundamentais para que ocorra a fotossíntese é a H2O e é dela que sai o oxigênio liberado para a atmosfera.

4  4 – A temperatura e a intensidade luminosa não afetam a taxa da fotossíntese.

13. (UFVJM)

“Luz do Sol

Que a folha traga e traduz

Em verde novo

Em folha, em graça, em vida, em força…”

(Luz do Sol – Caetano Veloso)

O fenômeno descrito poeticamente nesse trecho da música Luz do Sol, de Caetano Veloso, pode ser representado quimicamente conforme demonstrado neste quadro.

13

Com base no fenômeno natural apresentado, assinale a alternativa incorreta.

a) A energia luminosa é convertida em energia química, que mantém as ligações entre os átomos dos produtos formados na reação química.

b) A energia solar será transformada ao longo de toda a cadeia alimentar, sendo convertida em calor, trabalho, formação de ligações químicas, etc.

c) A energia solar é absorvida pela clorofila presente em certos organismos e esse fenômeno, descrito em linguagens poética e química, refere-se à fotossíntese.

d) A energia da radiação solar é utilizada para romper as ligações químicas entre os átomos da molécula de dióxido de carbono, convertendo-a em oxigênio molecular.

14. O aquecimento global, ocasionado pelo aumento do efeito estufa, tem como uma de suas causas a disponibilização acelerada de átomos de carbono para a atmosfera. Essa disponibilização acontece, por exemplo, na queima de combustíveis fósseis, como a gasolina, os óleos e o carvão, que libera o gás carbônico (CO2) para a atmosfera. Por outro lado, a produção de metano (CH4), outro gás causador do efeito estufa, está associada à pecuária e à degradação de matéria orgânica em aterros sanitários. Apesar dos problemas causados pela disponibilização acelerada dos gases citados, eles são imprescindíveis à vida na Terra e importantes para a manutenção do equilíbrio ecológico, porque, por exemplo, o:

a) Metano é fonte de carbono para os organismos fotossintetizantes.

b) Metano é fonte de hidrogênio para os organismos fotossintetizantes.

c) Gás carbônico é fonte de energia para os organismos fotossintetizantes.

d) Gás carbônico é fonte de carbono inorgânico para os organismos fotossintetizantes.

e) Gás carbônico é fonte de oxigênio molecular para os organismos heterotróficos aeróbios.

15. (PUC-MG) O processo fotossintético ocorre em duas etapas: a fase clara e a fase escura. Nas Angiospermas,a fotossíntese ocorre nos cloroplastos.

15

Observando-se o esquema dado, é correto afirmar, exceto:

a) A fotólise da água ocorre em 1.

b) A liberação de oxigênio ocorre em 2.

c) A liberação de ATP e NADPH2 ocorre em 1.

d) A utilização de água e de CO2 ocorre, respectivamente, em 1 e 2.

16. (MACKENZIE) Durante a etapa fotoquímica da fotossíntese, ocorrem:

a) Formação de ATP e síntese de glicose.

b) Formação de O2 e síntese de glicose.

c) Fotólise da água, formação de ATP e NADPH2.

d) Formação de NADPH2 e síntese de glicose.

e) Fotólise de NADPH2 e síntese de glicose.

17. (UEL) Analise a figura a seguir.

17

Qual das curvas sugeridas, na figura, representa a variação da fixação de CO2 em relação à temperatura para uma planta submetida a uma intensidade luminosa constante?

a) A.

b) B.

c) C.

d) D.

e) E.

18. O oxigênio gasoso é utilizado pela grande maioria dos seres vivos atuais como agente que participa da degradação de carboidratos. Esse processo gera, como resíduos, moléculas de água,dióxido de carbono e energia. Mesmo assim, após bilhões de anos,ainda possuímos uma atmosfera com maior concentração de oxigênio gasoso que dióxido de carbono. Assinale a alternativa abaixo que represente uma explicação mais plausível para a manutenção das concentrações atmosféricas:

a) O dióxido de carbono é absorvido por bactérias e fungos que o decompõem novamente em oxigênio atmosférico.

b) Plantas utilizam o dióxido de carbono para fazer respiração vegetal.

c) Seres autótrofos fotossintetizantes podem absorver dióxido de carbono para formar carboidrato, com liberação de oxigênio.

d) Os seres vivos utilizam tão pouco oxigênio gasoso que este não afeta a concentração atmosférica.

e) Plantas liberam muito oxigênio, mas não o utilizam na sua respiração.

19. (VUNESP) A fotossíntese ocorre em duas etapas: fotoquímica e química. Pode-se afirmar:

a) Elas são independentes e ocorrem no interior dos cloroplastos.

b) A etapa fotoquímica sintetiza carboidrato e a etapa química libera oxigênio.

c) O Ciclo de Calvin-Benson ocorre na etapa química e se dá no estroma dos cloroplastos.

d) Na etapa química, ocorre a fotólise da água e ela se dá nos tilacoides dos cloroplastos.

e) Na etapa fotoquímica, ocorre a fotofosforilação e a fixação do carbono.

20. Uma das folhas de uma planta foi parcialmente coberta com uma tira de papel-alumínio, como mostra a figura abaixo:

20

Durante alguns dias, essa planta foi exposta à luz uniforme. A respeito desse experimento, são feitas as seguintes afirmativas:

I. A região coberta torna-se amarelada por causa da destruição da clorofila.

II. As regiões não cobertas da folha apresentarão maior quantidade de amido que a porção coberta.

III. Na região coberta, os processos prejudicados são a quebra da molécula de água e a produção de ATP.

Assinale:

a) Se todas forem corretas.

b) Se somente I e II forem corretas.

c) Se somente II e III forem corretas.

d) Se somente I for correta.

e) Se somente II for correta.

21. (PUC-SP) Os trechos I e II, a seguir, referem-se ao processo de fotossíntese.

I. Em 1937, Robin Hill, da Universidade de Cambridge, trabalhou com cloroplastos isolados em lugar de plantas intactas. Forneceu às organelas mantidas in vitro, água, luz e um aceptor de hidrogênio.

II. Na década de 1940, Melvin Calvin, da Universida­de da Califórnia, forneceu a uma alga, gás carbônico marcado com o isótopo 14. Esse carbono ra­dioativo foi encontrado em moléculas orgânicas 30 segundos após iniciada a fotossíntese.

Ao ler atentamente os trechos indicados por I e II, um estudante do Ensino Médio fez cinco afirmações. Assinale a única incorreta.

a) Em I temos resumida uma etapa denominada “fotólise da água”.

b) Em I descreve-se uma etapa onde há desprendimento de oxigênio.

c) Em II descreve-se uma etapa onde há produção de glicose.

d) Em I e II temos resumidas etapas da fotossíntese que obrigatoriamente se realizam em presença de luz.

e) Em I e II temos resumidas etapas que ocorrem no interior de cloroplastos.

22. (VUNESP)

22

Em 1, onde se encontra a fonte de luz, a planta está no ponto de compensação fótico. Deslocando-se a fonte de luz para o ponto 2, a planta:

a) Vai deixar de eliminar Oe CO2.

b) Vai eliminar mais Oque CO2.

c) Vai eliminar menos Oe CO2.

d) Vai eliminar menos O2 e CO2.

e) Tenderá a eliminar quantidades iguais de Oe CO2.

23. (UFMS) Com relação ao processo de fotossíntese, assinale o que for correto:

I    II

0   0 – Os produtos da etapa fotoquímica são as moléculas de ATP, NADPH e gliceraldeído.

1   1 – A Rubisco (ribulose bifosfato carboxilase) é a enzima que catalisa a reação final do Ciclo de Calvin.

2   2 – A etapa bioquímica ocorre no cloroplasto, na membrana do tilacoide.

3   3 – A etapa fotoquímica ocorre no cloroplasto, na membrana do tilacoide.

4   4 – O oxigênio liberado para a atmosfera provém da fotólise da água.

24. (UEL) Analise as frases sobre os fatores que influem na fotossíntese.

I. As radiações luminosas menos absorvidas pelas clorofilas são verde e amarelo.

II. Plantas umbrófilas têm ponto de compensação elevado e por isso vivem em ambientes com deficiência luminosa.

III. Uma planta passa a eliminar CO2 quando exposta a uma intensidade luminosa abaixo do ponto de compensação fótico.

IV. O gráfico a seguir representa a influência da temperatura na taxa fotossintética, fixando-se a luz em intensidade alta (I) e intensidade baixa (II).

24

Estão corretas:

a) Apenas I e II.

b) Apenas I e III.

c) Apenas II e IV.

d) Apenas III e IV.

e) Apenas I e IV.

25. (UEM) A fotossíntese consiste, basicamente, na conversão da energia luminosa em energia química. Por esse processo, os organismos clorofilados assimilam carbono, na forma de gás carbônico, e liberam o gás oxigênio. Sobre a fotossíntese e o metabolismo do carbono nas plantas, assinale o que for correto.

I    II

0  0 – O ATP é um dos elos entre a clorofila, que capta energia luminosa, e os compostos orgânicos, que armazenam energia química.

1  1 – Durante a etapa química da fotossíntese, ocorre a produção de glicose e a liberação de oxigênio a partir da fotólise de moléculas de água.

2  2 – A taxa de fotossíntese pode ser estimada pela quantidade de CO2 que a planta absorve. No entanto, há certa intensidade luminosa em que a quantidade de CO2 absorvido é igual à quantidade de CO2 liberado na respiração, conhecida como ponto de compensação.

3  3 – Como a fotossíntese depende da luz absorvida pela folha, esse processo é mais eficiente nas faixas correspondentes à luz verde.

4  4 – A glicose produzida na fotossíntese e transportada pelas células do floema é utilizada na respiração que, nos vegetais, ocorre apenas nas células dos órgãos não iluminados e desprovidos de pigmentos.

26. (VUNESP) Um professor realizou um experimento para verificar as trocas gasosas que ocorrem nos organismos. Preparou três tubos de ensaio da seguinte maneira:

Tubo I – água e ramo de Elodea (angiosperma de água doce).

Tubo II – água e algumas planárias.

Tubo III – água, ramo de Elodea e quatro planárias.

Todos os tubos receberam gotas de azul de bromotimol (substância indicadora que adquire cor amarela em meio ácido). Eles foram fechados, de modo que não houvesse troca de gases com o meio ambiente e deixados recebendo diferentes intensidades luminosas. Os tubos I e II ficaram próximos da fonte de luz. Já o tubo III recebeu luz em menor intensidade que os tubos anteriores, fazendo com que a Elodea ficasse no ponto de compensação fótico. Sabendo que o gás carbônico dissolvido em água forma um ácido, pode-se afirmar que os tubos I, II e III, irão adquirir, após algum tempo, respectivamente, as cores:

a) Azul, azul e amarelo.

b) Amarelo, azul e amarelo.

c) Amarelo, amarelo e azul.

d) Amarelo, azul e azul.

e) Azul, amarelo e amarelo.

27. (UNISC) Na fotossíntese, dois estágios sequenciais ocorrem nos cloroplastos: 1) Primeiro a luz com certos comprimentos de onda é capturada e convertida em energia química por uma série de passos chamados de reações de luz, ou reações luminosas, ou ainda fase clara; e 2) o CO2 é fixado e reduzido a compostos orgânicos, particularmente açúcares, por uma série de passos chamados de reações no escuro, ou fixação de CO2, ou ainda fase escura. Essas reações ocorrem, respectivamente:

a) Nos citocromos e no estroma.

b) Na membrana do tilacoide e no estroma.

c) Na molécula antena e nos centros de reação.

d) No estroma e na molécula antena.

e) Os dois estágios ocorrem no estroma.

28. (UEPB) Pesquisadores do Instituto de Tecnologia de Massachusetts desenvolveram uma célula solar, do tamanho de um baralho de cartas, que imita a fotossíntese. Os cientistas acreditam que a folha artificial é uma fonte de energia elétrica promissora e de baixo custo (Planeta, jun/2011). Acerca do processo fotossintético assinale a alternativa correta.

a) O ponto de compensação fótico de uma planta é a intensidade de luz em que o volume de CO2 produzido na respiração é exatamente igual àquele consumido na fotossíntese.

b) A folha artificial terá seu melhor rendimento quando exposta aos comprimentos de onda do infravermelho, assim como as folhas naturais que têm maior taxa fotossintética quando iluminadas por luz verde.

c) A folha artificial deve conter células eletrônicas especiais responsáveis pela transformação da luz solar em energia elétrica, semelhante aos estômatos, organelas da célula vegetal onde ocorre a fotossíntese.

d) A fotossíntese é afetada apenas pela concentração de gás carbônico na atmosfera e pela intensidade luminosa.

e) Dentre os organismos vivos, as plantas são os únicos capacitados a realizar a fotossíntese.

29. (UERGS) Responda esta questão com base na ilustração abaixo, que esquematiza uma planta terrestre típica que utiliza luz do sol e dióxido de carbono da atmosfera para formar compostos orgânicos pela fotossíntese.

29

Os componentes ambientais que participam da fotossíntese substituem correta e respectivamente, os números 1, 2 e 3 por:

a) CO2, O2 e H2O.

b) CO2, H2O e O2.

c) O2, O2 e H2O.

d) O2, CO2 e H2O.

e) O2, H2O e CO2.

30. (UERGS) Qual das frases abaixo elucida melhor o “dilema” diário de um estômato?

a) “Abrir para absorver O2 para a fotossíntese ou fechar para garantir a retenção de água para a respiração?”.

b) “Abrir para liberar o CO2 da respiração ou fechar para garantir a retenção de água da fotossíntese?”.

c) “Abrir para absorver CO2 para a fotossíntese ou fechar para evitar a perda de água pela transpiração?”.

d) “Fechar para reter O2 para a fotossíntese ou abrir para permitir a saída de água da transpiração?”.

e) “Fechar para reter O2 para a respiração ou abrir para permitir a saída de água da fotossíntese?”.

31. (IFNMG) Sabemos que a fotossíntese é um fenômeno imprescindível à vida na Terra, onde, através dela, os seres fotossintetizantes produzem o seu próprio alimento e também o oxigênio, que é liberado para a atmosfera. O esquema abaixo representa as duas fases que ocorrem durante o fenômeno da fotossíntese. Observando o sentido das setas, indique os respectivos nomes das substâncias ou moléculas que representam as letras A, B, C, D, E, F, G e H.

31

Fonte: http://djalmasantos.wordpress.com/2010/10/03/testes-de-bioenergetica-1. Acesso em 25/06/2012.

a) H2O – O2 – CO2 – glicose – ATP –ADP – NADPH2 – NADP.

b) H2O – O2 – CO2 – glicose – ADP – ATP – NADPH2 – NADP.

c) O2 – H2O – glicose – CO2 – ADP – ATP – NADPH2 – NADP.

d) O2 – H2O – glicose – CO2 – ADP – ATP – NADP – NADPH2.

32. (UFTM) O gráfico representa a variação na taxa de fotossíntese de plantas mantidas em condições ideais de luminosidade e de concentração de gás carbônico em função da temperatura.

32

A reta pontilhada indica a temperatura ótima para a realização da fotossíntese. A curva que indica corretamente a continuidade do fenômeno é a de número:

a) 3, porque o cloroplasto é induzido a produzir mais clorofila e isso leva certo tempo.

b) 3, porque inicialmente as enzimas perdem a função e outras são sintetizadas lentamente.

c) 4, porque as enzimas alteram suas formas e deixam de exercer suas funções na fotossíntese.

d) 2, porque, após a temperatura ótima, as enzimas estão saturadas deixando a fotossíntese constante.

e) 1, porque a temperatura elevada potencializa a atividade das enzimas que atuam na fotossíntese.

33. (UEPB) Em regiões tropicais, como nosso país, certas plantas apresentam adaptações às condições ambientais, tais como alta intensidade luminosa, altas temperaturas e baixa disponibilidade de água. Nessas condições, os estômatos podem permanecer fechados por muito tempo durante o dia, o que reduz a transpiração da planta, mas também restringe a entrada de gás carbônico, fundamental para o processo de fotossíntese. Assim, nessas regiões, foram identificadas plantas com diferentes estratégias adaptativas, no que diz respeito ao processo fotossintético. Sobre o tema acima exposto são apresentadas as proposições a seguir. Relacione as colunas com o tipo de planta que as apresenta.

I. Plantas C3.

II. Plantas C4.

III. Plantas CAM.

A. O milho e a cana-de-açúcar são exemplos de plantas……. .

B. Nessas plantas o ciclo C4, ocorre durante a noite e, durante o dia, o ácido málico, formado no citosol e armazenado no vacúolo de suco celular, é liberado e origina CO2, que entra no Ciclo de Calvin.

C. Nessas plantas os ciclos C3 e C4 ocorrem em células distintas e podem ser concomitantes.

D. Nessas plantas, o CO2 entra no ciclo de Calvin e se une à ribulose bifosfato (RuBP); o produto de seis carbonos resultante é instável e, por ação da rubisco, formam-se duas moléculas de ácido fosfoglicérico (PGA).

E. Os cactos e o abacaxi são exemplos de plantas……. .

Assinale a opção que apresenta a relação correta entre as colunas.

a) II-D; III-E; II-C; I-A; III-B.

b) II-E; III-C; II-D; I-B; III-A.

c) II-A; III-B; II-E; I-C; III-D.

d) II-C; III-D; II-A; I-E; III-B.

e) II-A; III-B; II-C; I-D; III-E.

34. (FUVEST) O fitoplâncton consiste em um conjunto de organismos microscópicos encontrados em certos ambientes aquáticos. O desenvolvimento desses organismos requer luz e CO2, para o processo de fotossíntese, e requer também nutrientes contendo os elementos nitrogênio e fósforo. Considere a tabela que mostra dados de pH e de concentrações de nitrato e de oxigênio dissolvidos na água, para amostras coletadas durante o dia, em dois diferentes pontos (A e B) e em duas épocas do ano  (maio e novembro), na represa Billings, em São Paulo.

34

I. Nessas amostras, existe uma forte correlação entre as concentrações de nitrato e de oxigênio dissolvidos na água.Com base nas informações da tabela e em seus próprios conhecimentos sobre o processo de fotossíntese, um pesquisador registrou três conclusões:

II. As amostras de água coletadas em novembro devem ter menos CO2 dissolvido do que aquelas coletadas em maio.

III. Se as coletas tivessem sido feitas à noite, o pH das quatro amostras de água seria mais baixo do que o observado.

É correto o que o pesquisador concluiu em:

a) I, apenas.

b) III, apenas.

c) I e II, apenas.

d) II e III, apenas.

e) I, II e III.

35. (UNISINOS) A fotossíntese é o processo metabólico pelo qual organismos utilizam a energia da luz solar para conversão de dióxido de carbono e água em carboidratos e oxigênio (figura abaixo).

35

(Disponível em http://vivace.no.comunidades.net/in dex.php?

pagina=1145235940_01. Acesso em 13 abr. 2012).

Sobre o processo fotossintético, avalie as seguintes afirmativas.

I. A fotossíntese é realizada por todos os organismos heterotróficos.

II. Os vegetais superiores realizam as trocas gasosas através de pequenas aberturas em suas folhas, denominadas estômatos.

III. A clorofila é um pigmento que ocorre nas células vegetais e é responsável pela captura e absorção da energia da luz solar.

IV. O processo de fotossíntese retira o gás carbônico (CO2) atmosférico e armazena nas plantas, contribuindo assim para o aumento dos gases estufa e, consequentemente, para o aquecimento global.

Sobre as proposições acima, pode-se afirmar que:

a) Apenas II e IV estão corretas.

b) Apenas I, II e III estão corretas.

c) Apenas I, II e IV estão corretas.

d) Apenas II e III estão corretas.

e) Todas as proposições estão corretas.

36. (PUC-RIO) A fotossíntese é um processo complexo que ocorre em duas fases: fase luminosa e Ciclo de Calvin. Sobre as duas etapas da fotossíntese, foram feitas as seguintes afirmativas:

I. Na fase luminosa, ocorre a conversão da energia solar em energia química.

II. Na fase luminosa, ocorre liberação de oxigênio, produção de NADPH e consumo de ATP.

III. No Ciclo de Calvin, o CO2 atmosférico é incorporado em moléculas orgânicas do cloroplasto.

IV. O Ciclo de Calvin necessita indiretamente da luz, pois a produção de açúcar depende do ATP e NADPH produzidos na fase luminosa.

Estão corretas:

a) Somente I, II e III.

b) Somente II, III e IV.

c) Somente I, III e IV.

d) Somente I, II e IV.

e) Todas as afirmativas.

37. (FPS) Mudanças no clima do planeta alteram fatores abióticos que influenciam o comportamento fisiológico das plantas.  Por exemplo, o processo fotossintético das plantas é afetado pelas concentrações de CO2, temperatura e luminosidade ambientais, dentre outros. Considerando seus conhecimentos botânicos, é correto afirmar que:

a) Em condições ideais de temperatura e luminosidade, plantas submetidas a altas concentrações de CO2 abrem seus estômatos e têm aumentadas as taxas de fotossíntese.

b) Em condições ideais de concentração de gás carbônico e luminosidade, plantas submetidas a temperaturas crescentes fecham seus estômatos e têm diminuídas as taxas de fotossíntese.

c) Em condições ideais de concentração de gás carbônico e temperatura, plantas submetidas a alta intensidade luminosa abrem seus estômatos e têm aumentadas as taxas de fotossíntese.

d) Em condições ideais de temperatura e luminosidade, o baixo suprimento hídrico da planta estimula a abertura dos estômatos e o aumento das taxas de fotossíntese.

e) Em condições ideais de concentração de gás carbônico e luminosidade, o alto suprimento hídrico da planta estimula a fechamento dos estômatos e o aumento das taxas de fotossíntese.

38. (PUC-GO)                                TEXTO

Há pessoas que vivem para destruir. Nasceram no fosso da ignorância e lá construíram o seu mundo de ódio, de desprezo, de traição. Fazem cursos de guerra, especializam-se no manuseio de armas bélicas e exercitam-se diariamente no processo de delação. Têm a língua afiada, pronta para soltar vitupérios e o dedo médio lambuzado de titica e enrijecido de tantas deduragens. São obscuras, raivosas, traidoras, covardes e vivem no anonimato. Têm como lema a destruição. Se não posso ser notável, ser importante, ser escritor, por exemplo, que ninguém o seja. E aí, no laboratório de sua insignificância destilam ódio contra aqueles que estão construindo, mostrando ao mundo que ainda e possível plantar rosas e fabricar perfumes.

(TELES, Jose Mendonca, Crônicas de mim. Goiânia: Kelps, 2011. p. 127.)

No texto acima é feita referência ao potencial destrutivo de algumas pessoas, o que também acaba por atingir a natureza, em seus vários aspectos: “Há pessoas que vivem para destruir. Nasceramno fosso da ignorância e lá construíram o seu mundode ódio, de desprezo, de traição. Fazem cursos deguerra, especializam-se no manuseio de armas bélicas eexercitam-se diariamente no processo de delação.” A alteração do meio ambiente provoca danos que podem ser sentidos pelas populações do mundo inteiro, como o efeito estufa, que tem levado ao aumento da temperatura no planeta. No Brasil, o desmatamento e as queimadas têm causado uma dupla preocupação, pois, além de as queimadas lançarem na atmosfera gases de efeito estufa, a derrubada de árvores diminui a taxa de fixação do carbono pela fotossíntese, contribuindo para ampliar o problema. Sobre o processo de fotossíntese, assinale a alternativa correta:

a) A fotólise da agua produz o desdobramento do CO2 em carbono e oxigênio.

b) A fotossíntese pode ser dividida em duas etapas: a etapa luminosa ou fotoquímica e a etapa química ou enzimática.

c) Nos cloroplastos contidos nas folhas, o único pigmento envolvido no processo fotossintético e a clorofila.

d) No chamado Ciclo de Calvin, o açúcar formado pelas reações da fotossíntese é a sacarose.

39. (UDESC) Analise as proposições abaixo, em relação às plantas:

I. São seres autótrofos e produzem seus alimentos.

II. As plantas fazem fotossíntese através dos leucoplastos, como os amiloplastos que armazenam amido.

III. A clorofila é responsável pela absorção de energia luminosa indispensável à fotossíntese.

IV. Na fotossíntese ocorre a transformação do gás carbônico e da água em açúcar.

V. A fotossíntese consome oxigênio e produz gás carbônico.

Assinale a alternativa correta.

a) Somente as afirmativas I e IV são verdadeiras.

b) Somente as afirmativas II e V são verdadeiras.

c) Somente as afirmativas I, II e III são verdadeiras.

d) Somente as afirmativas I, III e IV são verdadeiras.

e) Somente as afirmativas I, III e V são verdadeiras.

40. (FCMSC-SP) Supondo que as 3 plantas mostradas no esquema abaixo sejam da mesma espécie e perfeitamente iguais, e sabendo-se que a II está no ponto de compensação fótico, mantendo-se a fonte de luz F em A, ocorre que:

40

a) A I está eliminando mais O2 que a II.

b) A II está eliminando mais CO2 que a I.

c) A III está eliminando mais O2 que a I.

d) A III está eliminando mais CO2 que a II.

e) Nada do que foi dito nas alternativas anteriores está ocorrendo.

GABARITO

GAB

 

 

 

 

Publicado por: Djalma Santos | 1 de abril de 2014

Testes de associações biológicas (1)

01. No intervalo da aula de Biologia, um aluno contou a seguinte piada:

Dois cervos conversavam e passeavam pela mata quando um deles gritou:

— Uma onça!!! Vamos correr!!!

Ao que o outro respondeu:

— Não adianta correr, ela é mais veloz que qualquer um de nós.

— Eu sei. Mas a mim basta ser mais veloz que você.

O diálogo entre os cervos exemplifica um caso de:

a) Competição interespecífica.

b) Competição intraespecífica.

c) Seleção natural.

d) Irradiação adaptativa.

e) Mimetismo.

02. (FCM-PB) Organismos realizam competição intraespecífica; quase sempre disputam recursos do meio ambiente, como também se auxiliam mutuamente, trocando benefícios. Assinale a alternativa correta que demonstra as relações interespecíficas.

a) Mutualismo – algas e fungos formam liquens.

b) Parasitismo – hienas que aproveitam restos das presas dos leões.

c) Comensalismo – gavião, que devora outros pássaros e roedores.

d) Inquilinismo – helmintos que parasitam o intestino humano.

03. (IFMG) Em comunidades biológicas, os seres vivos mantêm diversas relações entre si. Essas relações podem ser intraespecíficas, quando acontecem entre seres da mesma espécie, ou interespecíficas, quando acontecem entre seres de espécies diferentes. A seguir são feitas afirmações sobre relações entre seres vivos. Todas estão corretas, exceto:

a) Mutualismo é um tipo de associação permanente entre seres vivos de duas espécies distintas, com benefício para ambos. Um exemplo de mutualismo é a associação entre algumas algas e fungos, formando líquens.

b) As abelhas vivem em grupos nos quais os trabalhos são divididos entre seus diferentes membros. Esse tipo de associação recebe o nome de protocooperação.

c) Competição é um tipo de relação ecológica em que os indivíduos disputam recursos do meio. Pode ocorrer entre organismos de mesma espécie ou entre indivíduos de espécies diferentes.

d) No parasitismo, um indivíduo, denominado parasita, se associa a outro indivíduo, chamado hospedeiro. O parasita retira seu alimento do hospedeiro, causando-lhe prejuízos. Um exemplo de parasitismo é a associação entre lombrigas e seres humanos.

04. (MACK) Se duas populações de animais de espécies diferentes, que pertencem ao mesmo gênero e ocupam o mesmo nicho ecológico, forem colocadas num mesmo meio, espera-se que:

a) Ocorra competição entre elas e ambas desapareçam.

b) Se adaptem ao meio, reduzindo, cada uma, sua população à metade.

c) Uma delas vença a competição, determinando a eliminação da outra.

d) Ocorra mutualismo e ambas aumentem suas populações.

e) Ambas continuem com o mesmo número populacional.

05. (UEA) As relações ecológicas desarmônicas são importantes para o controle populacional, pois afetam diretamente o tamanho das populações das espécies envolvidas na relação. São relações ecológicas desse tipo:

a) Competição, comensalismo e mutualismo.

b) Predatismo, parasitismo e competição.

c) Protocooperação, competição e predatismo.

d) Parasitismo, inquilinismo e herbivorismo.

e) Parasitismo, comensalismo e inquilinismo.

06. (UNIOESTE) Selecione a(s) alternativa(s) verdadeira(s) relativamente às relações que os seres vivos mantêm entre si.

I   II

0  0 – Entre os cnidários, a caravela e muitos corais são exemplos de colônias.

1  1 – Disputando résteas de luz, as orquídeas parasitam os galhos das árvores, nas matas do litoral paranaense.

2  2 – A rêmora parasita o tubarão, fixando-se nele com suas ventosas.

3 3 – A solitária é um parasita monogenético porque se desenvolve sozinha no intestino do homem.

4 4 – Ratos e preás que disputam a posse do mesmo habitat, mantêm uma relação intraespecífica.

07. (IFSudeste-MG) Os microrganismos probióticos são aqueles que conseguem melhorar o bem-estar dos seus animais hospedeiros. Uma das principais ações desses microrganismos é o controle da microbiota intestinal. Essa regulação, muitas vezes, ocorre pela liberação de substâncias que controlam o crescimento populacional de microrganismos patogênicos. Qual é o tipo de relação ecológica entre essas espécies de microrganismos (probiótico e patogênico)?

a) Parasitismo.

b) Competição intraespecífica.

c) Competição interespecífica.

d) Predação.

e) Mimetismo.

08. (FCM-PB) Nas relações ecológicas, os organismos de uma comunidade biológica interagem entre si, essas relações se estabelecem entre indivíduos da mesma espécie (relações intraespecíficas) ou ocorrem entre indivíduos de espécies diferentes (relações interespecíficas). Assinale a alternativa correta quanto às relações ecológicas.

a) Helmintos que parasitam o intestino humano – é uma interação denominada comensalismo.

b) A associação de plantas epífitas sobre árvores – é uma interação denominada predação.

c) A associação entre algas e fungos forma liquens – é uma interação denominada mutualismo.

d) A associação caranguejo-eremita e a anêmona do mar – é uma associação não obrigatória denominada parasitismo.

e) Animais que se alimentam do mesmo tipo de planta – é uma interação denominada inquilinismo.

09. (UNICENTRO) As rêmoras alimentam-se de fragmentos de comida deixados pelo seu tubarão hospedeiro, bem como de invertebrados pelágicos e pequenos peixes. Esses peixes, então, ficam com as “migalhas” que sobram quando o tubarão captura sua presa (1º caso). Porém, agora, sabe-se que algumas rêmoras também se alimentam de ectoparasitas de tubarões. O tubarão hospedeiro, portanto, pode beneficiar-se da situação quando os ectoparasitas que vivem presos à sua pele são removidos pela rêmora (2º caso). Esse texto descreve duas interações ecológicas entre seres de diferentes espécies. Assinale a alternativa que apresenta, correta e respectivamente, as interações que ocorrem no 1º e 2º casos.

a) Competição e comensalismo.

b) Mutualismo e comensalismo.

c) Comensalismo e mutualismo.

d) Inquilinismo e parasitismo.

e) Parasitismo e inquilinismo.

10. Nas comunidades, os indivíduos interagem entre si, exercendo influências nas populações envolvidas, de maneira positiva ou negativa.

10

Nesse contexto, a predação é uma interação ecológica em que:

a) Há perda para ambas as espécies, por se tratar de uma associação interespecífica.

b) A especificidade presa-predador é determinante, pois os predadores se alimentam de um único tipo de presa.

c) Há uma íntima associação entre duas espécies, manifestada por um comportamento canibalístico.

d) A população de predadores poderá determinar a população de presas e vice-versa.

11. (UNCISAL) Os seres vivos mantêm entre si vários tipos de interações ecológicas que podem ser harmônicas ou desarmônicas. Na harmônica não há prejuízo para as espécies que participam e vantagem para uma delas. Na desarmônica um dos participantes é prejudicado, podendo existir benefícios para um deles. As interações podem ocorrer entre indivíduos da mesma espécie ou de espécies diferentes. A frase “o carão tá na lagoa beliscando o aruá” expressa a forma como os brejeiros da Várzea da Marituba, uma área alagada do baixo São Francisco alagoano, percebem a relação trófica entre a ave o carão (Aramus guarauna) e o molusco gastrópode o aruá (Pomacea sp.), fornecendo inclusive o local (lagoa) e a forma como acontece (beliscando).

                    MARQUES, J. G. W. Pescando pescador: Ciência e Etnociência em uma Perspectiva ecológica. São Paulo: NUPAUB, USP, 2001 (adaptado)

Qual o tipo de relação ecológica que há entre o carão e o aruá?

a) Parasitismo.

b) Mutualismo.

c) Protocooperação.

d) Predatismo.

e) Comensalismo.

12. (UNISSINOS)

12

(Disponível em http://veja.abril.com.br/assets/images/2012/12/115373/extincao-polinizadores-20121214-size-620.jpg?1355527832. Acesso em 24 set. 2013.)

Uma preocupação recente em relação à pro­dução de alimentos é a grande mortandade de abelhas. Trata-se de um fenômeno em que abelhas abandonam suas colmeias, deixan­do para trás suas crias e alimento. O colap­so das colmeias coloca em risco não só as abelhas, mas também as lavouras de grãos e frutas, que dependem da polinização de suas flores pelas abelhas. Não ocorrendo isso, há uma consequente diminuição da produção de alimentos.

As relações ecológicas que ocorrem entre as abe­lhas na colmeia e entre as abelhas e as flores, no processo de polinização são, respectivamente:

a) Sociedade e Mutualismo.

b) Colônia e Protocooperação.

c) Inquilinismo e Comensalismo.

d) Colônia e Mutualismo.

e) Sociedade e Protocooperação.

13. (ACAFE) Em 1928, Alexander Fleming desenvolvia pesquisas sobre estafilococos. No mês de agosto daquele ano tirou férias e, por esquecimento, deixou algumas placas com culturas de estafilococos sobre a mesa. Quando retornou ao trabalho, em setembro, observou que algumas das placas estavam contaminadas com mofo. Notou que havia, em uma das placas, um halo transparente em torno do mofo contaminante, o que parecia indicar que aquele fungo produzia uma substância bactericida. O fungo foi identificado como pertencente ao gênero Penicilium, donde deriva o nome de penicilina dado à substância por ele produzida. Fleming passou a empregá-la em seu laboratório para selecionar determinadas bactérias, eliminando das culturas as espécies sensíveis à sua ação.

 Fonte: http://usuarios.cultura.com.br/jmrezende/penicilina.htm

A relação ecológica observada por Fleming entre a bactéria e o fungo pode ser definida como:

a) Parasitismo do tipo endoparsitose em que, neste caso, o fungo é o hospedeiro.

b) Amensalismo do tipo antibiose em que uma espécie, neste caso o fungo, produz substância que, lançadas no meio, dificulta a vida ou até provoca a morte de outras espécies.

c) Parasitismo do tipo holoparasitose em que, neste caso, o fungo parasita metabolizará os nutrientes sugados das bactérias.

d) Amensalismo do tipo canibalismo em que, neste caso, as bactérias predam-se a si mesmas.

14. (UEA) A inexistência de complexos climatizados em muitas indústrias processadoras de salames e o controle não totalmente efetivo das condições ambientais nas câmaras climatizadas existentes nessas indústrias favorece o desenvolvimento de fungos indesejáveis sobre esses produtos. Esses fungos podem produzir micotoxinas ou antibióticos no interior das embalagens, o que traria sérios problemas à saúde pública. Para evitar contaminações, as empresas utilizam agora outro tipo de fungo de baixa toxicidade e que se mostra mais eficiente na colonização na superfície dos embutidos. Dessa forma, impede-se o crescimento de colônias de outros fungos. Considerando as relações entre os seres vivos, encontram-se no texto exemplos, respectivamente, de:

a) Parasitismo e predatismo.

b) Competição e parasitismo.

c) Predatismo e competição.

d) Amensalismo e parasitismo.

e) Amensalismo e competição.

15. (UDESC) Analise a alternativa correta quanto às relações entre os seres vivos.

a) A protocooperação é um exemplo de relação intraespecífica desarmônica, em que dois seres de espécies diferentes mantêm relações obrigatórias e benéficas, e não conseguem viver independentes.

b) O canibalismo é um exemplo de relação interespecífica harmônica, em que um ser se alimenta de outro ser de sua própria espécie ou de outra espécie.

c) A competição é um exemplo de relação interespecífica harmônica, em que os indivíduos não são prejudicados quando competem por alimento e luz.

d) A predação é um exemplo de relação interespecífica desarmônica, em que um ser mata outro ser de espécie diferente para se alimentar.

e) O inquilinismo é um exemplo de relação intraespecífica desarmônica, em que dois seres de espécies diferentes mantêm relações benéficas, mútuas e obrigatórias, e conseguem viver de forma independente.

16. (UEM) Sobre as comunidades biológicas, assinale a(s) alternativa(s) correta(s).

I   II

0  0 – Colônia é uma relação ecológica entre indivíduos da mesma espécie que cooperam entre si sem estarem unidos.

1 1 – Inquilinismo é uma relação ecológica interespecífica, onde a espécie hospedeira, geralmente uma planta, cresce sobre outra lhe causando prejuízos.

2 2 – A competição interespecífica é caracterizada por ocorrer entre seres de espécies diferentes, cujos nichos ecológicos se sobrepõem.

3 3 – Comensalismo é um tipo de associação interespecífica em que os seres envolvidos interagem trocando benefícios.

4  4 – Herbivorismo é a relação ecológica interespecífica em que uma das espécies envolvidas é heterotrófica e se alimenta de outra espécie, que é autotrófica.

17. (UNITAU) Duas populações de paramécios foram criadas separadamente, sob condições e recursos limitados, para determinar suas capacidades de suporte, como mostra o gráfico da Figura A. Posteriormente, esses protozoários foram criados juntos, sob as mesmas condições do experimento anterior, como mostra o gráfico da Figura B, para se determinar o efeito de uma população sobre a outra.

17

A diferença no crescimento populacional observado é o resultado de qual das interações propostas abaixo?

a) Mutualismo.

b) Competição.

c) Comensalismo.

d) Amensalismo.

e) Cooperação.

18. (INSTITUTO FEDERAL DE SÃO PAULO) Muitos seres vivos estabelecem relações ecológicas entre si e podem ter benefício ou prejuízo ou ainda ser indiferentes na relação. Alguns exemplos dessas relações foram descritas a seguir.

I. Os peixes-piloto ficam à espera de restos de alimentos desprezados por tubarões. Estes, por sua vez, não são prejudicados e nem beneficiados pelos peixes-piloto.

II. Seres vivos que vivem em castas não conseguem viver isoladamente, dependem uns dos outros em todas as fases da vida e existe uma nítida divisão de funções.

III. As lebres podem ser abatidas por onças, que as utilizam como fonte de alimento. A população de lince tem um papel importante no equilíbrio da população de lebres.

IV. Muitas orquídeas ficam em cima de troncos de árvores obtendo o suprimento de luz para a fotossíntese. As árvores não são beneficiadas e nem prejudicadas pelas orquídeas.

As relações ecológicas descritas correspondem, respectivamente, a:

a) I – mutualismo; II – colônia; III – protocooperação; IV – comensalismo.

b) I – comensalismo; II – sociedade; III – predatismo; IV – epifitismo.

c) I – protocooperação; II – colônia; III – predatismo; IV – inquilinismo.

d) I – protocooperação; II – sociedade; III – parasitismo; IV – epifitismo.

e) I – comensalismo; II – colônia; III – mutualismo; IV – inquilinismo.

19. O termo “biodiversidade” refere-se ao número de espécies que coexistem em um ecossistema, participando de complexas interações ecológicas e do ciclo da matéria desse meio ambiente. Podemos encontrar, nos ecossistemas, relações destes tipos:

I. Um pólipo de coral não vive sozinho sem fazer parte de um grupo de indivíduos da sua espécie.

II. Espécies de angiospermas preferencialmente utilizam um animal polinizador para sua reprodução.

III. Uma planta fixa-se sobre outra, retirando a seiva elaborada através de finíssimas raízes.

As relações ecológicas acima descritas podem ser classificadas, respectivamente, como:

a) Colônia, mutualismo, amensalismo.

b) Sociedade, comensalismo, predatismo.

c) Colônia, protocooperação, parasitismo.

d) Sociedade, protocooperação, endoparasitismo.

e) Colônia, inquilinismo, parasitismo.

20. Descrevemos, abaixo, algumas relações entre seres vivos numerados de I a V e uma lista de tipos de associações biológicas, precedidos por um numeral.

I. O bernardo-eremita, um crustáceo marinho, transporta actínia e esta, em troca, proporciona-lhe proteção.

II. Alguns crocodilos, após se alimentarem, abrem a boca, momento em que a ave-palito come detritos alimentares presos aos seus dentes e também vermes da garganta deles.

III. Algas com cogumelos formam os liquens. O fungo fornece proteção, sustentação e matéria bruta alimento.

IV. A Physalia ou caravela é uma associação na qual os indivíduos possuem formas diferentes conforme o trabalho desempenhado.

V. Os pulgões sugam a seiva elaborada das plantas.

Tipos de associações biológicas:

1 – Protocooperação

2 – Amensalismo

3 – Parasitismo

4 – Epifitismo

5 – Predatismo

6 – Mutualismo

7 – Colônia

Assinale a alternativa que faça a perfeita correlação entre a relação descrita e o tipo de associação.

a) I – 2; II – 2; III – 5; IV – 1; V – 7.

b) I – 3; II – 1; III – 4; IV – 6; V – 6.

c) I – 1; II – 1; III – 6; IV – 7; V – 3.

d) I – 2; II – 3; III – 1; IV – 3; V – 7.

e) I – 7; II – 2; III – 2; IV – 4; V – 6.

21. (UFRGS) Leia as definições a seguir, referentes a tipos de interações ecológicas que ocorrem entre os organismos em uma comunidade.

I. Sociedade: associação anatômica entre indivíduos da mesma espécie que passam a formar uma unidade estrutural e funcional.

II. Colônia: interação entre indivíduos de uma mesma espécie em que há divisão de trabalho.

III. Protocooperação: associação facultativa entre indivíduos de espécies diferentes, em que ambos se beneficiam.

Quais estão corretas?

a) Apenas I.

b) Apenas III.

c) Apenas I e II.

d) Apenas II e III.

e) I, II, III.

22. (UFMS) No esquema mostrado a seguir, estão representadas interações alimentares em uma comunidade no Pantanal.

22

Assinale a alternativa em que estão relacionados os animais que são competidores.

a) Capivara, cervo-do-pantanal, pequenos roedores.

b) Onça-pintada, pequenos roedores, gavião-preto.

c) Jiboia, onça-pintada, pequenos roedores.

d) Gavião-preto, onça-pintada, capivara.

e) Jiboia, capivara, gavião-preto.

23. (PUC-SP) (…) Para começo de conversa, o coral duro da espécie Acropora millepora está morto: é só uma lembrança literalmente desbotada do organismo coletivo que vicejava sobre o exoesqueleto calcário que restou. Desbotamento ou bleeching, de fato, é o nome da praga associada ao aquecimento global que ameaça o maior e mais famoso conjunto de corais do mundo, os 2.000 km da Grande Barreira a leste da Austrália (…)

Outro grande flagelo dos corais é a coroa-de-espinhos (Acanthaster planci), uma espécie de estrela-do-mar, o único predador natural especializado nesses condomínios de pólipos que enfeitam o mar (…)

A coroa-de-espinhos consome o tecido mole do coral, que é rico em carboidratos, dos quais o coral retira 80% de sua energia e que são produzidos por fotossíntese por algas dinoflageladas do tipo zooxanthellae. (…)

Essas algas marrons são organismos unicelulares que cada pólipo de coral duro abriga dentro de suas próprias paredes (…) a alga sintetiza alimento (amido) usando energia da luz solar, e o coral lhe dá abrigo e substâncias contendo carbono que servem de matéria-prima para o microrganismo realizar a fotossíntese. (…)

As zooxanthellae são muito sensíveis à mudança de temperatura. Basta uma variação de 1°C ou 2°C para que abandonem as paredes do pólipo coralino, provocando a morte do parceiro. Sem as algas para lhe dar cor, o coral desbota – daí o fenômeno o bleeching.

                  LEITE, Marcelo. “Flagelo de Corais”. Folha de S. Paulo – Caderno Mais! – 27 de junho de 2004, adaptado.

A partir da leitura do texto, é incorreto afirmar que:

a) A poluição térmica compromete a sobrevivência do cnidário colonial da espécie Acropora millepora.

b) O coral e a zooxanthellae mantêm uma relação de mutualismo.

c) Acropora millepora é presa de Acanthaster planci.

d) O coral não sobrevive sem a presença das algas dinoflageladas.

e) O coral é predador das zooxanthellae.

24. (PUC-MG) Leia com atenção o texto a seguir.

Na década de 50, uma espécie inofensiva de capim foi importada da África para ser usada como pastagem, e o capim annoni veio como contaminante e apareceu no meio da pastagem. Sem saber do potencial invasor da planta, o fazendeiro Ernesto José Annoni passou a multiplicar e a vender as sementes do capim, que batizou com o seu sobrenome.

“É um verdadeiro desastre ecológico”, afirma o engenheiro florestal José Carlos dos Reis. O capim annoni destrói e toma o lugar das pastagens naturais e, o que é pior, não serve para alimentar o gado. Com raízes desenvolvidas, essa planta exótica puxa mais água e nutrientes do solo que as nativas e ainda produz um herbicida que mata as outras plantas.                                                

Reportagem “Espécies invasoras”, de Galileu, nº 145, agosto de 2003.

Analisando-se o texto dado, é correto afirmar:

a) O capim annoni destrói a espécie inofensiva de capim importado da África.

b) O texto apresenta um exemplo de amensalismo e de competição interespecífica.

c) Na África, o capim annoni é mais eficiente na obtenção de água e nutrientes que as espécies nativas.

d) Esse capim contamina as pastagens naturais, infectando-as e causando doenças.

25. (UEL) Analise a figura a seguir.

25

A ilusão é um fenômeno comum na natureza, o que torna a camuflagem eficaz. Com base na figura e nos conhecimentos sobre o tema, considere as afirmativas a seguir.

I. A incapacidade de voo das mariposas adultas é compensada pelo efeito visual capaz de enganar os olhos do predador.

II. A camuflagem dos animais é determinada pela pouca mobilidade e pelo repouso por períodos prolongados.

III. O importante na camuflagem é produzir semelhanças com os elementos do ambiente, imitando cores e/ou formas.

IV. A camuflagem é utilizada na natureza por animais em situação de defesa e de ataque, como forma de garantir a sua sobrevivência.

Estão corretas apenas as afirmativas:

a) I e II.

b) I e III.

c) III e IV.

d) I, II e IV.

e) II, III e IV.

26. (UFSCAR-SP) A seguir estão descritas algumas relações entre seres vivos:

I – A rêmora acompanha o tubarão de perto e fica presa a ele por uma ventosa. Ela aproveita os alimentos do tubarão e também a sua locomoção, mas não prejudica e nem beneficia o seu hospedeiro.

II. A alimentação predominante do cupim é a madeira, que lhe fornece grande quantidade de celulose. Entretanto, ele não possui capacidade digeri-la. Quem se responsabiliza pela degradação da celulose é um protozoário que vive em seu intestino, de onde não precisa sair para procurar alimento.

III. As ervas-de-passarinho instalam-se sobre outras plantas, retirando delas a seiva, que será utilizada para a fotossíntese.

IV. Nas caravelas existe uma união estreita de indivíduo, cada um deles especializados em determinadas funções como digestão, reprodução e defesa.

V. As orquídeas, vivendo sobre outras plantas, conseguem melhores condições luminosas, mas nada retiram dos tecidos internos destas plantas.

Essas relações referem-se, respectivamente, a:

a) Mutualismo, comensalismo, hemiparasitismo, colônia, parasitismo.

b) Comensalismo, mutualismo, hemiparasitismo, colônia, epifitismo.

c) Comensalismo, mutualismo, epifitismo, colônia, hemiparasitismo.

d) Mutualismo, comensalismo, parasitismo, sociedade, epifitismo.

e) Hemiparasitismo, mutualismo, parasitismo, colônia, epifitismo.

27. (CESGRANRIO) No combate às larvas dos anofelinos (mosquitos transmissores da malária), foi utilizado, com eficiência, um pequeno peixe larvófago (Gambusia affinis). A utilização desse animal, na área de saneamento para o controle dessa parasitose, foi bem sucedida em regiões infestadas pelo Anopheles, e onde era grande a incidência da malária. O método citado, não poluente, substitui o clássico processo de deposição de óleo em superfície da água, que mata as larvas por asfixia. A ação do peixe Gambusia affinis em relação aos anofelinos é um exemplo de:

a) Predatismo.

b) Parasitismo.

c) Comensalismo.

d) Mutualismo.

e) Amensalismo.

28. (UNAMA) O cipó-chumbo 1 (Cuscuta sp) e a erva-de-passarinho 2 (Struthantus flexicaulis) são plantas parasitas de outras plantas porque retiram da planta hospedeira o seu alimento. Sobre esse assunto, coloque “V” ou “F” ao lado de cada afirmativa, conforme estejam certas ou erradas:

I. Ambas pertencem à mesma espécie embora apresentem gêneros distintos.

II. Ambas pertencem ao mesmo gênero, porém são de espécies diferentes.

III. 1 extrai a seiva elaborada da planta hospedeira por meio dos haustórios.

IV. 2 extrai substâncias inorgânicas da planta hospedeira.

V. 1 não apresenta clorofila nas folhas e 2 tem folhas clorofiladas.

Na sequência de cima para baixo, o correto está em:

a) V, V, V, V, V.

b) F, F, V, V, V.

c) F, V, F, F, V.

d) V, F, F, V, V.

29. (UFPel) Um pesquisador estudando o meio ambiente e suas inter-relações captura uma coruja que carregava em suas patas um pequeno camundongo. Examinando a coruja, depara-se com suas penas repletas de carrapatos e piolhos. Nota, ainda, que o camundongo está com seus pelos infestados de pulgas. Baseado no texto e em seus conhecimentos assinale as relações interespecíficas existentes, respectivamente, entre coruja e o camundongo, entre os carrapatos e piolhos e entre as pulgas e o camundongo.

a) Inquilinismo – competição – parasitismo.

b) Competição – parasitismo – competição.

c) Parasitismo – predatismo – competição.

d) Predatismo – parasitismo – inquilinismo.

e) Predatismo – competição – parasitismo.

30. (UFJF) O parasitismo é uma relação de forte dependência na qual um organismo (parasita) sobrevive retirando nutrientes de outro organismo (hospedeiro). Analise as alternativas abaixo a respeito do parasitismo:

I. Os parasitas sempre levam o hospedeiro à morte.

II. Os parasitas são eficientes quando utilizados no controle biológico, por exemplo, insetos pragas de plantações.

III. Os parasitas sempre vivem no interior do corpo dos hospedeiros.

IV. Os hospedeiros sempre são prejudicados.

V. No reino vegetal, não existem parasitas.

São corretas as alternativas:

a) I e III.

b) II e IV.

c) II e V.

d) I, III e IV.

e) III, IV e V.

GABARITO

01

02

03

04

05

06

07

08

09

10

C

A

B

C

B

VFFFF

C

C

C

D

11

12

13

14

15

16

17

18

19

20

D

A

B

E

D

FFVFV

B

B

C

C

21

22

23

24

25

26

27

28

29

30

B

A

E

B

C

B

A

B

E

B

Publicado por: Djalma Santos | 25 de março de 2014

Testes de genética molecular (1)

01. (IFB) A partir da interpretação da figura abaixo, que ilustra esquematicamente o fluxo da informação genética, é correto concluir:

01

a) O DNA celular é construído pela associação de pequenos segmentos de mRNA.

b) O material genético do cromossomo é estruturado em uma cadeia simples e única de nucleotídeos.

c) A cadeia polipeptídica se estabelece no processo de tradução, conforme a sequência polinucleotídica do mRNA.

d) A formação de mRNAs, a partir de pré-mRNAs, é um evento que se inclui na etapa de decodificação da informação gênica.

e) A molécula de mRNA associada aos ribossomos estabelece uma estrutura permanente que garante a síntese contínua de proteínas.

02. (FCM-PB) A vida pode ser definida como um conjunto de reações químicas organizadas de um modo a permitir que esse conjunto se reproduza. Para dar continuidade de uma geração para a seguinte, o DNA tem que ser quimicamente estável e copiado com precisão durante a replicação. A sequência codificadora de um gene é: 5’ – GCGATGCCATCA – 3’.  Qual é a sequencia da fita complementar desta molécula de DNA?

a) 3’ – TACTCCGGTACT – 5’.

b) 3’ – UACTCCGGTCGT – 3’.

c) 5’ – TCCGGTCGTUCT – 3’.

d) 3’ – ACGTGCGGAACT – 5’.

e) 3’ – CGCTACGGTAGT – 5’.

03. (UEG) As proteínas são polímeros de aminoácidos, cuja sequência é determinada geneticamente. Vinte aminoácidos diferentes são codificados por trincas de bases do DNA, conforme determinado pelo código genético. Em relação a esse código, verifica-se que:

a) A combinação de duas bases nitrogenadas em grupos de três resulta em 60 trincas possíveis.

b) O código é degenerado, visto que cada proteína pode ser codificada por uma mesma trinca.

c) Cada polipeptídio tem uma sequência específica de aminoácidos determinada pelo gene.

d) Quatro trincas não codificam aminoácidos, visto que determinam o fim do polipeptídeo.

04. (UCB) Considerando o gene representado abaixo, que produz duas proteínas, uma de 600 aminoácidos e outra de 530 aminoácidos, julgue os itens seguintes.

04

I   II

0  0 – O esquema representa um gene bacteriano.

1  1 – O gene não existe, porque um gene não pode produzir dois tipos de proteína.

2  2 – As regiões codificadoras são os éxons e os introns são não codificadores.

3 3 – Um indivíduo com deleção (perda) de vinte bases no início do éxon 3 produzirá proteína(s) defeituosa(s).

4  4 – Os três éxons possuem segmentos de DNA codificantes e não codificantes.

05. (FATEC) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados por molduras e são utilizadas setas para indicar o sentido das proposições. O mapa conceitual a seguir refere-se à relação entre cromossomos e proteínas, e nele quatro conceitos foram omitidos.

05

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por:

a) RNA, DNA, aminoácidos e nucleotídeos.

b) RNA, DNA, nucleotídeos e aminoácidos.

c) DNA, RNA, nucleotídeos e aminoácidos.

d) DNA, RNA, monossacarídeos e aminoácidos.

e) DNA, RNA, monossacarídeos e nucleotídeos.

06. (FCM-PB) Em 1978, o geneticista norte-americano Walter Gilbert, estudando o processo de transcrição em eucariotos, propôs os termos éxon, para designar as regiões de um gene que são traduzidas em sequencias de aminoácidos, e introns para designar as regiões não traduzidas. No entanto, o RNA primariamente transcrito feito diretamente de um molde de DNA não é a forma biológica final do RNA. Ainda dentro do núcleo a molécula de RNA recém-sintetizada passa por uma série de reações químicas até ser transformada no mRNA que participará da síntese de proteínas. Sobre as etapas de processamento do RNA, antes de atingir a forma funcional das proteínas, podemos afirmar corretamente que:

I   II

0  0 – A enzima RNA polimerase transcreve tanto as regiões dos éxons quanto a dos introns, produzindo uma molécula de mRNA correspondente a toda unidade de transcrição.

1  1 – O splicing significa a remoção dos introns de uma molécula de RNA pré-mensageiro.

2  2 – A molécula de RNA pré-mensageiro é cortada no limite entre os introns e os dois éxons adjacentes, que são imediatamente unidos entre si.

3  3 – A enzima DNA polimerase III transcreve tanto as regiões dos éxons quanto a dos introns, produzindo uma molécula de mRNA correspondente a toda unidade de transcrição.

4  4 – O splicing significa corte e colagem com a remoção dos éxons de uma molécula de RNA pré-mensageiro.

07. (IFMG) Considere a seguinte sequência de DNA:

A A T C G A T T C G C A T G C

Sobre essa sequência, são feitas as seguintes afirmações:

I. A sequência da fita de DNA complementar é U U A G C U A A G C G U A C G.

II. São representados cinco códons.

III. A partir da sequência de DNA apresentada, é transcrito o RNA mensageiro com a sequência:

T T A G C T A A G C G T A C G.

IV. Desconsiderando-se os códons de iniciação e de parada, a sequência de DNA apresentada dará origem a um pentapeptídeo.

Estão corretas as afirmativas:

a) I, III.

b) II, IV.

c) I, II, III.

d) I, II, III, IV.

08. (IFB.) As células musculares esqueléticas contêm uma rede de filamentos precisamente alinhados compostos de proteínas contráteis; as células cartilaginosas se tornam rodeadas por uma matriz característica, contendo polissacarídeos e proteínas colágenas, que juntas provêm o suporte mecânico; os eritrócitos se tornam um pacote em forma de disco preenchido com uma única proteína, a hemoglobina, que transporta o oxigênio.

           (Karp, Gerald. Biologia Celular e Molecular: conceitos e experimentos. Tradução de Maria Dalva Cesário, et al. Barueri, SP: Manole, 2005, p. 16)

A especialização da célula, configurada no texto na descrição de alguns tipos celulares, envolve um mecanismo básico comum que se reconhece como a:

a) Aquisição de mecanismos próprios a cada tipo celular para a síntese das proteínas.

b) Diversificação dos modelos de organização da membrana plasmática.

c) Preservação da divisão mitótica com a redução progressiva do volume celular.

d) Transcrição diferencial do gene que amplia o potencial do genoma para a síntese de proteínas.

e) Diversificação do genoma, estabelecido na fecundação, no decorrer do desenvolvimento do organismo.

09. (FCM-PB) Até a década de quarenta, não se conhecia ainda um tratamento adequado, eficaz para os diversos tipos de doenças infecciosas. A partir de então, muitas pesquisas foram realizadas e foram descobertas várias substancias com capacidade de bloquear o crescimento bacteriano. Essas substâncias com efeito antibiótico impossibilitam os ribossomos de realizar sua função. Sabe-se que o efeito imediato desse antibiótico sobre as células bacterianas sensíveis a ele é de impedir a síntese de:

a) ATP.

b) DNA.

c) RNA mensageiro.

d) Lipídios presentes na parede bacteriana.

e) Proteínas.

10.  (CEDERJ) Um grupo de pesquisadores sequenciou o genoma completo de uma determinada bactéria e verificou a presença de 30% de adenina no conteúdo de bases aminadas do DNA. Qual a porcentagem das outras bases aminadas no DNA desta bactéria?

a) Timina 30%, guanina 20% e citosina 20%.

b) Timina 70%, guanina 30% e citosina 70%.

c) Timina 30%, guanina 70% e citosina 70%.

d) Timina 20%, guanina 30% e citosina 20%.

11. (IFMT) Nosso DNA não desbota como um pergaminho antigo, não enferruja no solo, como a espada de um guerreiro morto há muito tempo. Não é erodido pelo vento ou pela chuva, nem reduzido a ruínas por fogo e terremotos. É o viajante de uma terra antiga que mora dentro de todos nós (SYKES, 2003, PL 13). O segmento exclusivo não recombinante do cromossomo Y e o DNA mitocondrial possuem particularidades genéticas que os tornam atraentes para o estudo da história humana. Primeiro, eles são herdados de apenas um dos pais: o cromossomo Y é transmitido pelo espermatozoide apenas para descendentes do sexo masculino e o DNAmt é transmitido por meio do óvulo para filhos e filhas. Em segundo lugar, não trocam genes com segmentos genômicos semelhantes, ou seja, não sofrem recombinação, sendo transmitidos em bloco às gerações seguintes (RINCON, 2009, PG 11-12).

Seguindo esse raciocínio, é possível afirmar que a genética evolutiva auxilia na:

I. Elucidação das origens do homem moderno.

II. Apresentação dos padrões de dispersão das populações humanas.

III. Demonstração dos padrões de diversidade genética das populações humanas.

IV. Possibilidade da constituição genética de uma determinada população.

Está correto o que se afirma em:

a) I e II, apenas.

b) II e III, apenas.

c) I, II e III, apenas.

d) I, II, III e IV.

12. (FCM-PB) James Watson e Francis Crick (1953) esclareceram a estrutura tridimensional da dupla hélice do DNA e postularam que o pareamento específico existentes nas bases nitrogenadas propõe um provável mecanismo de cópia para o material genético. Com base nessas informações, o processo de duplicação do DNA é dito como sendo semiconservativo porque:

a) Os dois filamentos de dupla hélice original se fragmentam e servem de molde para a síntese de novos fragmentos.

b) Um dos filamentos da dupla original serve de cópia para as duas fitas de DNA.

c) A dupla hélice original permanece intacta sendo que uma nova dupla hélice é formada.

d) Os dois filamentos da dupla hélice original se separam e cada um serve como molde para uma nova fita.

e) As fitas da dupla hélice original permutam as suas fitas ou filamentos para servirem de cópias de DNA.

13. (FATEC) Os códons são modelos propostos pelos bioquímicos para representar o código genético. São constituídos por três bases nitrogenadas no RNA, e cada uma delas é representada por uma letra:

A = adenina U = uracila C = citosina G = guanina

O modelo para o códon:

a) Poderia ter duas letras, uma vez que o número de aminoácidos é igual a oito.

b) É universal, porque mais de uma trinca de bases pode codificar um mesmo aminoácido.

c) É degenerado, porque mais de um códon pode codificar um mesmo aminoácido.

d) É específico, porque vários aminoácidos podem ser codificados pelo mesmo códon.

e) É variável, uma vez que aminoácidos diferentes são codificados pelo mesmo códon.

14. (UNIOESTE) Com relação a genes, ácidos nucléicos e o fluxo da informação genética, é correto afirmar:

a) Que a diferença entre as bases púricas e pirimídicas está no número de pontes de hidrogênio, sendo 3 pontes de hidrogênio para as bases púricas e 2 pontes de hidrogênio para as bases pirimídicas.

b) Que a duplicação do DNA é bidirecional e semiconservativa.

c) Que o fluxo da informação genética não ocorre, em circunstância alguma, de RNA para DNA, mas ocorre sempre de DNA para RNA.

d) Que, em eucariotos, os genes são transcritos no citoplasma.

e) Que, composicionalmente, DNA e RNA diferem entre si apenas pela presença das bases nitrogenadas Timina e Uracila, respectivamente.

15. (UEPA)

Leia com atenção o texto para responder esta questão.

Informações sobre nossos ancestrais podem ser desvendadas pela análise do DNA. Esta ferramenta permite distinguir entre os brasileiros, as contribuições genômicas relativas às três raízes ancestrais: europeia, africana e ameríndia.

                   Adaptado de http://cienciahoje.uol.com.br/colunas/derivagenetica/ genealogia-linhagens-ancestrais-e-dna

Sobre a molécula orgânica referida no texto, afirma-se que:

I. É formada por duas cadeias ou fitas de nucleotídeos, uma em torno da outra, formando uma dupla hélice.

II. Ao longo da vida pode ser exposta a diversos fatores externos que podem danificar sua molécula e modificar sua mensagem genética inicial.

III. Em interação com o RNA, ribossomos e outros elementos celulares, promove a síntese de proteínas.

IV. Nos eucariotos é encontrada no núcleo formando os cromossomos.

A alternativa que contém todas as afirmativas corretas é:

a) I, II e III.

b) I, II e IV.

c) I, III e IV.

d) II, III e IV.

e) I, II, III e IV.

16. (UNIOESTE) O esquema a seguir representa o fluxo da informação genética em uma célula eucariótica.

16

Com relação ao esquema acima, é correto afirmar que:

I    II

0   0 – O processo 2 é caracterizado pela adição de aminoácidos pelo ribossomo.

1   1 – 2 representa o processo denominado tradução.

2   2 – 1 e 2 ocorrem no núcleo da célula e 3 ocorre no citoplasma.

3   3 – O processo 1 é apenas semiconservativo e realizado por DNAs polimerases.

4   4 – 1 representa o processo denominado duplicação.

17. (FCM-PB) A maioria das mutações é muito pequena, envolvendo um número de nucleotídeos, ou grande envolvendo cromossomos inteiros. As anomalias nos eucariotos podem ocorrer por:

I. Deleção: perde-se um segmento do cromossomo.

II. Translocação: troca entre dois cromossomos não homólogos, após as quebras de ambos os filamentos de DNA.

III. Poliploidia: presença de três ou mais cópias do genoma por núcleo celular.

IV. Aneuploidia: causada pela não disjunção cromossômica, uma falha dos cromossomos homólogos em se separarem durante a meiose.

São corretas as afirmações:

a) I e III, apenas.

b) II, III e IV, apenas.

c) II e IV, apenas.

d) III e IV, apenas.

e) I, II, III e IV.

18. (CEFET-MG) O DNA apresenta diferentes níveis de condensação, conforme representado na figura.

18

No momento em que o DNA de uma célula somática humana for visualizado no nível “F” de condensação, está ocorrendo o processo de:

a) Síntese de proteínas.

b) Multiplicação celular.

c) Permutação cromossômica.

d) Produção de ácido ribonucleico.

e) Duplicação do material genético.

19. (PUC-RIO) Sobre o processo de replicação do DNA, é incorreto afirmar que:

a) Cada molécula de DNA nova é composta por um filamento antigo e um filamento recém-sintetizado.

b) Não há a necessidade de um primer de RNA para a polimerização do filamento contínuo.

c) A polimerização se processa no sentido 5’→3’.

d) Mais de um tipo de DNA polimerase participa do processo.

e) Esse processo ocorre bidirecionalmente.

20. (FCM-PB) ”Dentre os componentes da cromatina, o DNA é o banco de informações genéticas e vetor para várias gerações celulares (Carvalho, A Célula, 2001).” Sabendo-se que as células procarióticas não possuem material genético individualizado por um envelope nuclear como ocorre com as células eucarióticas, assinale a alternativa correta:

a) Nos seres procarióticos só ocorre o processo de transcrição, não ocorrendo a tradução.

b) O processo de transcrição e de tradução nos seres procarióticos ocorre simultaneamente, enquanto que nos seres eucarióticos a transcrição ocorre no núcleo e a tradução ocorre no citoplasma.

c) Tanto nos seres procarióticos quanto nos seres eucarióticos a transcrição e a tradução ocorrem no citoplasma celular.

d) Tanto nos seres procarióticos quanto nos seres eucarióticos a transcrição e a tradução ocorrem no núcleo da célula.

e) O processo de transcrição e de tradução nos seres eucarióticos ocorre no mesmo local, enquanto que nos seres procarióticos, a transcrição ocorre no núcleo e a tradução ocorre no citoplasma, em tempo e espaços distintos.

21. (CEFET-MG) Analise o gráfico abaixo.

21

A presença de genomas maiores, mas relativamente com menos genes funcionais, representa uma vantagem adaptativa pelo fato de reduzir a:

a) Variabilidade genética.

b) Ocorrência de transcrições.

c) Complexidade do material genético.

d) Vulnerabilidade às mutações deletérias.

e) Frequência dos mecanismos de evolução.

22. (UECE) Uma mutação severa foi identificada numa família humana. As sequências de bases nitrogenadas sem a mutação (normal) e com a mutação (sublinhada e marcada com uma seta) estão representadas no quadro abaixo. Em ambas as sequências, estão em destaque o sítio de início da tradução e a base alterada.

22

Tomando por base o quadro acima, que apresenta uma sequência sem mutação (normal) e uma sequência mutante de uma doença humana severa, assinale a opção que corresponde ao ácido nucleico representado e ao número de aminoácidos codificados pela sequência de bases entre o sítio de início da tradução e a mutação.

a) DNA; 8.

b) DNA; 24.

c) RNA; 8.

d) RNA; 24.

23. (FCM-PB) Um paciente procura o médico e diz que apresenta crises frequentes de faringoamigdalites e costuma se automedicar utilizando sempre o mesmo antibiótico. No entanto, nas últimas vezes, o medicamento não surtiu efeito. O médico explica que uso abusivo e indiscriminado de antibióticos na prática clínica tem efeito seletivo no surgimento de bactérias resistentes e que os mecanismos genéticos envolvidos neste processo são a mutação e a recombinação. Marque a opção correta com relação aos mecanismos de transmissão do material genético em bactérias.

a) A transmissão do material genético ocorre apenas por transdução, o DNA bacteriano é transferido entre células mediado por vírus.

b) A conjugação e a transformação são mecanismos de transmissão do material genético, que exigem contato físico entre células doadoras e receptoras.

c) A transmissão do material genético de uma bactéria para outra ocorre por três mecanismos: conjugação, transformação e transdução.

d) No processo de recombinação gênica conjugação, o DNA livre no meio é adsorvido pela célula bacteriana.

e) A transmissão do material genético ocorre de forma aleatória somente por conjugação.

24.  (UEM) “O recente acidente nuclear no Japão reacendeu a polêmica em torno desse tipo de geração de energia e está causando preocupação entre as populações que vivem próximas as usinas. Mesmo em Angra dos Reis, na Costa Verde Fluminense, onde não existe risco de tsunamis ou terremotos, parte da população está ainda mais aflita com um possível vazamento radioativo nas usinas Angra 1 e 2, criadas na década de 70. Uma possível falha humana ou no reator seria o suficiente para uma tragédia na região, que possui cerca de 200 mil habitantes”. (Texto extraído de < http://jornal.ofluminense.com.br/editorias/cidades/tragedia-no-japao-deixa-angra-dos-reis-na-costaverde-do-rjem-alerta&gt;. Acesso em 13/6/2011).

Com relação à radiação e seus efeitos no organismo humano, assinale o que for correto.

I   II

0  0 – Radiação ionizante é um agente físico que aumenta as taxas de mutação. Entretanto, essas alterações no genoma somente serão transmitidas aos seus descendentes, se ocorrerem nas células germinativas.

1  1 – Em comparação à radiação alfa e beta, a radiação gama tem maior poder de penetração no corpo humano. Por isso, é o tipo de radiação ionizante com maior potencial de provocar mutações no genoma.

2  2 – As mutações desencadeadas pela radiação ocorrem sempre no RNA mensageiro e não no DNA, já que o DNA está protegido deste tipo de mutação por moléculas que reparam as bases nitrogenadas alteradas.

3  3 – As radiações solares UVA e UVB têm baixo poder de penetração em nossa pele e podem causar câncer de pele.

4  4 – Mutações desfavoráveis (ou deletérias) podem ter sua frequência reduzida na população, por meio da seleção natural, enquanto mutações favoráveis (benéficas. ou vantajosas) podem se acumular, resultando em mudanças adaptativas.

25. (ALFENAS)  Uma das características do código genético é ser altamente degenerado. Isto quer dizer que:

a) Mais um aminoácido pode ser codificado pela mesma trinca de bases nitrogenadas.

b) Uma base nitrogenada de uma sequência pode pertencer a duas trincas diferentes.

c) Uma base nitrogenada integra apenas uma trinca.

d) O DNA pode sofrer alterações na composição de suas bases nitrogenadas.

e) Mais de uma trinca de bases nitrogenadas pode codificar um mesmo aminoácido.

26. (FCM-PB) A sequência: 3’ – ATGAGGCCAGCATGA – 5’ em um filamento molde de DNA codifica uma molécula de RNA com qual sequência?

a) 5’ – TACTCCGGTCGTACT – 3’.

b) 5’ – UACUCCGGUCGUACU – 3’.

c) 3” – ATGAGGCCAGCATGA – 5’.

d) 3’ – UAC TCCGGTCGTACT – 3’.

e) 5’ – TUCTCCGGTCGTUCT – 3’.

27. (PUC–RS) Em uma pesquisa, uma fita-dupla de DNA de leveduras foi construída usando-se isótopos pesados. Depois disso, essa fita-dupla passou por um ciclo de replicação, no qual foi permitido que as novas fitas de DNA fossem construídas com isótopos leves. Comparando-se o peso das amostras de DNA antes e depois da replicação, verificou-se que, devido à replicação:

a) Conservativa, preservam-se as fitas-duplas de DNA pesadas e produzem-se novas fitas leves.

b) Conservativa, formam-se novas fitas-duplas de DNA com cadeias leves entremeadas em cadeias pesadas.

c) Dispersiva, produzem-se novas fitas-duplas de DNA com cadeias leves intercaladas em cadeias pesadas.

d) Semiconservativa, as novas fitas-duplas de DNA ficam mais leves que a fita-dupla original.

e) Semiconservativa, formam-se novas fitas-duplas de DNA apenas com cadeias leves.

28. (IFSul) Em nosso planeta, todas as formas de vida têm suas informações genéticas codificadas nas sequências de bases nitrogenadas dos ácidos nucleicos. Analise as informações contidas nas sequências 1 e 2.

Sequência 1

                   TAAGATCCCGAATCGGTCGGCGATTTATCC

Sequência 2

                   ATTCTAGGGCTTAGCCAGCCGCTAAATAGG

De acordo com a análise, afirma-se:

I. As sequências 1 e 2 são complementares no DNA e, juntas, representam um segmento de  molécula de DNA.

II. Na sequência 1, estão representados 30 códons e 10 nucleotídeos

III. Se considerarmos a sequência 1 como molde, o RNAm formado por essa sequência conterá as mesmas bases nitrogenadas da sequência 2, substituindo a timina pelo uracil.

IV. Adenina, guanina, citosina e timina são aminoácidos essenciais, presentes em todos os seres vivos.

Estão corretas apenas:

a) I e III.

b) I, II e III.

c) II, III e IV.

d) II e IV.

29. (IFB) A conversão do ovo em feto e do feto em bebê é uma história biológica envolvendo eventos espetaculares que emergem de inter-relações perfeitamente ajustadas e complexas.

29

Em relação ao componente genético do feto, é correto considerar que:

a) Foi definido no momento da fecundação com a contribuição cromossômica diploide de cada progenitor.

b) Sofre modificações no decorrer do desenvolvimento por perdas e substituições de genes no processo de diferenciação das células.

c) Possui quantidades variáveis de genes paternos e maternos.

d) Obtém a especialização celular pelo processamento diferenciado dos mRNAs em função do ambiente celular.

e) É traduzido sob um código genético que é diferenciado para cada tecido.

30. (FCM-PB) A figura abaixo representa um dos fenômenos biológicos altamente especializados e com uma sofisticação invejável, a síntese proteica.

30

As letras A, B, C, D e E, representam respectivamente:

a) Ribossomos, RNAt, RNAm, polissacarídeos, monossacarídeos.

b) Ribossomos, RNAm, RNAt, polipeptídios, aminoácidos.

c) Ribossomos, RNAm, RNAt, polissacarídeos, aminoácidos.

d) Ribossomos, RNAt, RNAm, polipeptídios, monossacarídeos.

e) Ribossomos, RNAt, RNAm, polipeptídios, aminoácidos.

GABARITO

01

02

03

04

05

06

07

08

09

10

C

E

C

FFVVF

C

VVVFF

B

D

E

A

11

12

13

14

15

16

17

18

19

20

D

D

C

B

E

FFVFV

E

B

B

B

21

22

23

24

25

26

27

28

29

30

D

C

C

VVFVV

E

B

D

A

D

B

 

Publicado por: Djalma Santos | 18 de março de 2014

Testes de divisão celular (1)

01. (UNIOESTE) Os gráficos abaixo correlacionam a quantidade de DNA por núcleo com as fases do ciclo celular, em uma espécie com 2n = 2x = 4 cromossomos.

01

Interprete os gráficos acima e assinale a(s) alternativa(s) correta(s).

I   II

0  0 – Em ambos os gráficos, na fase 1a cada cromossomo apresenta 2 cromátides.

1 1 – Em 3 no gráfico 1 e em 7 no gráfico 2, os cromossomos homólogos encontram-se pareados.

2  2 – A intercinese ocorre entre as fases 5 e 6 do gráfico 2.

3  3 – Paquíteno e diacinese ocorrem na fase 6 do gráfico 2.

4  4 – Ao final da fase 9 no gráfico 2, são formadas 4 células com 4 cromossomos em cada célula.

02. (UEL) Considerando que uma espécie de ave apresenta 2n = 78 cromossomos é correto afirmar:

a) Um gameta tem 39 cromossomos autossomos e 2 cromossomos sexuais.

b) Um gameta tem 38 cromossomos autossomos e 2 cromossomos sexuais.

c) Um gameta tem 38 cromossomos autossomos e 1 cromossomo sexual.

d) Uma célula somática tem 77 cromossomos autossomos e 1 cromossomo sexual.

e) Uma célula somática tem 78 cromossomos autossomos e 2 cromossomos sexuais.

03. (FCM-PB) A divisão celular é o processo pelo qual organismos unicelulares se reproduzem e as células dos organismos multicelulares se multiplicam, possibilitando o crescimento. Considere as afirmações a seguir, assinalando-as com V (verdadeiro) ou F (falso).

I  II

0 0  – Na meiose as células resultantes contêm apenas um representante de cada um dos pares de cromossomos homólogos.

1  1 – Apenas a segregação independente conduz a diversidade genética.

2  2 – Na mitose as células haploides resultantes transformam-se em gametas funcionais.

3  3 – Na anáfase I da meiose ocorre a separação dos cromossomos, esta fase é reducional.

4  4 – Na metáfase II da meiose ocorre a separação dos cromossomos, esta fase é equacional.

04. (UFTM) Considere os seguintes eventos biológicos:

I. Origem de gêmeos dizigóticos.

II. Origem de gêmeos monozigóticos.

III. Recombinação do material genético.

IV. Organogênese.

V. Formação de blastômeros.

Pode-se afirmar que a meiose relaciona-se aos eventos:

a) I e III, enquanto a mitose relaciona-se aos eventos II, IV e V.

b) III e V, enquanto a mitose relaciona-se aos eventos I, II e IV.

c) IV e V, enquanto a mitose relaciona-se aos eventos I, II e III.

d) I, II e III, enquanto a mitose relaciona-se aos eventos IV e V.

e) I, II, IV e V, enquanto a mitose relaciona-se ao evento III.

05. (UNIFOR) A figura abaixo esquematiza uma célula meiótica em metáfase I.

05

A partir dessa célula, é possível prever-se a formação de gametas:

a) AB e ab, somente.

b) Aa e Bb, somente.

c) Ab e aB, somente.

d) AB, Ab, aB e ab.

e) AB e ab ou Aa e Bb.

06. (PUC-MG) O esquema representa células, 2n = 4 cromossomos, em diferentes fases de um processo de divisão celular.

06

Com base no esquema, é correto afirmar, exceto:

a) A célula representada em II apresenta cromossomos duplicados.

b) As duas células resultantes da divisão, mostradas em VI, são haploides.

c) Em III, fase denominada metáfase, não ocorre pareamento de cromossomos.

d) Não se observa no esquema a separação dos cromossomos homólogos.

07. (CEFET-MG) Analise o processo de divisão celular representado de forma simplificada.

07

A diferença numérica de cromossomos entre o início e o fim desse processo objetiva:

a) Manter a ploidia da espécie.

b) Impedir o surgimento de trissomias.

c) Diminuir o tempo do próximo ciclo celular.

d) Facilitar a duplicação do material genético.

e) Favorecer a eliminação de genes indesejáveis.

08. (UNIOESTE) O desenho abaixo representa um ciclo celular mitótico.

08

Relativo ao ciclo acima, analise as alternativas e assinale a(s) correta(s).

I   II

0  0  – Em 1 ocorrem a duplicação do DNA, a transcrição e a síntese proteica.

1  1  – Em 2 ocorrem o crossing-over e o paquíteno.

2  2  – Em 4 ocorre a separação dos cromossomos homólogos para polos opostos.

3  3 – Em 5 os cromossomos encontram-se com 2 cromátides cada um.

4 4 – A partir da célula diploide com 4 cromossomos, são formadas 2 células com 2 cromossomos cada.

09. (UEA) Existem drogas quimioterápicas usadas no tratamento de pacientes com câncer que impedem a formação de microtúbulos. Sua interferência no processo de divisão celular será:

a) No desaparecimento da carioteca.

b) No desaparecimento do nucléolo.

c) Na duplicação dos cromossomos.

d) Na condensação dos cromossomos.

e) Na migração dos cromossomos.

10. (FATEC) O manuseio de equipamentos de radiologia envolve riscos à saúde, e o Tecnólogo em Radiologia segue uma série de normas de biossegurança para evitar a exposição desnecessária à radiação ionizante. Esse tipo de radiação pode danificar suas células, levando-as a se reproduzir de modo desordenado e descontrolado, gerando inúmeras novas células por meio do mesmo processo de divisão celular que ocorre nas células somáticas. Desse modo, basta que uma única célula do corpo se danifique e torne-se uma célula cancerígena para que surja um tumor. Isso ocorre porque a célula cancerígena inicial divide-se por:

a) Mitose, gerando células com o mesmo número de cromossomos e a mesma capacidade de duplicação.

b) Mitose, gerando células com metade do número de cromossomos, porém ainda com capacidade de duplicação.

c) Mitose, gerando células com o dobro do número de cromossomos e uma capacidade ainda maior de duplicação.

d) Meiose, gerando células com o mesmo número de cromossomos e a mesma capacidade de duplicação.

e) Meiose, gerando células com metade do número de cromossomos, porém ainda com capacidade de duplicação.

11. (UFSCar) Considere que as abelhas da espécie Partamona helleri possuem 34 cromossomos, sendo que as fêmeas originam-se por reprodução sexuada e os machos, por partenogênese. É esperado que fêmeas e machos tenham nos núcleos de suas células somáticas, respectivamente:

a) 34 e 17 cromossomos.

b) 68 e 34 cromossomos.

c) 17 e 34 cromossomos.

d) 34 e 68 cromossomos.

e) 51 e 17 cromossomos.

12. (UNIOESTE) Analise o gráfico abaixo, que representa a meiose.

12

Com base no gráfico, pode-se afirmar que:

a) A meiose II se inicia no tempo 3.

b) A replicação do DNA na fase S da interfase tem início no tempo zero.

c) Entre os tempos 5 e 6, ocorre a separação dos cromossomos homólogos.

d) No tempo 5, a célula apresenta uma quantidade duplicada de cromossomos.

e) No tempo 2 e antes do tempo 3, ocorre permuta ou crossing-over entre os cromossomos homólogos.

13. (UEPG) Considerando os processos de mitose e meiose, assinale o que for correto.

I   II

0 0 – Nos processos cancerígenos, o tumor é decorrente de divisões descontroladas das células por meio da meiose, visto que novas combinações genéticas podem levar ao surgimento de mutações.

1  1 – Nos animais, a meiose ocorre durante a produção de gametas e, nos vegetais, a meiose é responsável pela formação dos esporos. Em organismos diploides, os gametas e os esporos são haploides.

2  2 – Na meiose, o evento de crossing-over ou recombinação permite trocas de segmentos entre os cromossomos homólogos, fazendo surgir novas combinações genéticas.

3 3 – Na fase de telófase mitótica, pode-se observar claramente os cromossomos ao microscópio óptico, pois os mesmos encontram-se em seu maior grau de compactação e localizados na região equatorial da célula.

4 4 – Na citocinese de uma célula animal, ocorre o estrangulamento da região equatorial causado por um anel de filamentos contráteis de moléculas de actina e miosina, fato que não ocorre nas células vegetais.

14. (FCM-PB) Na prófase I da meiose I, é correto afirmar que:

a) A formação do complexo sinaptonêmico ocorre na subfase diacinese.

b) A terminalização dos quiasmas ocorre na subfase do zigóteno.

c) O crossing-over ocorre na subfase do paquíteno.

d) A subfase diplóteno caracteriza-se pelos seus filamentos finos.

e) A subfase leptóteno caracteriza-se pela formação dos quiasmas.

15. (IFMT) A mosca da fruta ou Drosophila melanogaster apresenta 8 cromossomos em suas células somáticas. (LOPES, 2002). Após a mitose, para a multiplicação de suas células somáticas, e nas meioses reducional e equacional, para a formação dos gametas desse animal, a mosca da fruta apresentará, respectivamente, os números de cromossomos:

a) 4, 4 e 8.

b) 8, 6 e 4.

c) 8, 4 e 4.

d) 4, 8 e 6.

e) 8, 8 e 4.

16. (UFF) Examine as seguintes afirmativas referentes ao ciclo celular:

I. Quando uma célula sai da subfase S da interfase, apresenta o dobro de DNA.

II. Se a célula não estiver em processo de divisão, ocorre pouca atividade metabólica no núcleo interfásico.

III. Divisão celular é um processo que sempre dá origem a duas células geneticamente iguais.

IV. Na anáfase da primeira divisão da meiose não ocorre divisão dos centrômeros.

V. As células germinativas sofrem mitose.

As afirmativas verdadeiras são as indicados por:

a) I e II.

b) l e III.

c) I, IV e V.

d) II e III.

e) II, III e V.

17. (FCM-PB) Em relação ao processo de divisão celular mitótica, complete as afirmações e marque abaixo a alternativa que corresponde à seqüência correta:

I. A divisão longitudinal dos centrômeros caracteriza o inicio da fase da _______________.

II. Na fase da _______________, o nucléolo se desorganiza e o centro celular se duplica.

III. Na _______________, ocorre intensa movimentação das organelas que migram equitativamente para os polos da célula e os cromossomos alinham-se na placa equatorial.

IV. A citocinese das células vegetais é _______________.

a) prófase, metáfase, anáfase, centrípeta.

b) anáfase, prófase, metáfase, centrípeta.

c) anáfase, prófase, metáfase, centrífuga.

d) prófase, metáfase, anáfase, centrífuga.

e) anáfase, metáfase, prófase, centrípeta.

18. (FCM-PB) O gráfico demonstra o processo de divisão no ciclo celular. Assinale qual o principal evento correspondente aos números II, IV e VI.

18

a) II duplicação do DNA; IV divisão dos centrômeros; VI discreta síntese de RNA

b) II duplicação de RNA; IV redução do conteúdo de DNA; VI discreta síntese de RNA.

c) II discreta síntese de DNA; IV divisão das cromátides; VI separação dos cromossomos homólogos.

d) II duplicação do DNA; IV separação dos cromossomos homólogos; VI separação das cromátides irmãs.

e) II duplicação do conteúdo de DNA; IV separação das cromátides irmãs; VI separação dos cromossomos homólogos.

19. (PUC-MG)                 UMA CÉLULA QUE MUDOU DE TIME

O biólogo Jerry Borges relata um surpreendente resultado obtido por cientistas da Universidade de Guelph, no Canadá: eles mostraram que gametas femininos podem ser formados a partir de células da pele. Publicado na Nature Cell Biology, o estudo desafia um pilar da biologia do desenvolvimento.

                            (Fonte: Ciência Hoje online, 21 de abril de 2006.)

Sobre esse assunto, assinale a afirmativa incorreta.

a) A técnica descrita poderia ser útil para a produção de gametas em mulheres que não possuem ovários.

b) Os gametas femininos originados de células da pele de um mesmo indivíduo devem apresentar um mesmo patrimônio genético.

c) O sucesso do processo descrito dependeu da indução de meiose em uma célula somática.

d) Em condições normais, as crianças do sexo feminino apresentam, em seus ovários, ovócitos no início da primeira divisão meiótica.

20. (FCM-PB) Para o paciente J.S.T. portador de um diagnóstico de câncer, foi prescrito um tratamento quimioterápico, após o qual não houve mais formação de células oncogênicas (cancerosas). Com base nesta informação, podemos atribuir que nas células tumorais, a quimioterapia atuou em nível de:

a) Mitocôndrias, bloqueando a sua função de respiração aeróbica.

b) Lisossomos, bloqueando a digestão celular.

c) Ciclo celular, aumentando o processo de proliferação celular.

d) Em algum ponto do ciclo bloqueando a proliferação celular.

e) No Aparelho Golgiense, acelerando o processo de armazenamento da célula.

GABARITO

01

02

03

04

05

06

07

08

09

10

FFVFF

C

VFFVF

A

A

B

A

VFFFF

E

A

11

12

13

14

15

16

17

18

19

20

A

E

FVVFV

C

C

C

C

D

B

D

Publicado por: Djalma Santos | 10 de março de 2014

Transformação bacteriana

TRANSFORMAÇÃO BACTERIANA

Embora as bactérias não apresentem reprodução sexuada típica, algumas espécies são dotadas da capacidade de promover recombinação genética, sendo, portanto, capazes de modificar seu genótipo. Essa recombinação consiste, em última análise, na interação de duas moléculas de DNA que são clivadas e religadas entre si, num arranjo diferente do que existia anteriormente.  Dessa forma, essa mistura de material genético leva à formação de indivíduos com características genéticas diferentes. Os indivíduos, assim modificados, podem se dividir, inúmeras vezes, por bipartição (divisão binária) [ver PLASMÍDEOS (PLASMÍDEO F), matéria publicada neste blog em 04/06/2013]. A recombinação genética nas bactérias pode ocorrer, naturalmente, de três formas básicas: transformação, transdução e conjugação, que lembram, dentro de certos limites, a reprodução sexuada. A análise desses processos, que se tornou disponível durante a década de 1950, forneceu, em função de serem a base do mapeamento genética, informações valiosas acerca dos genes bacterianos. Em todos os processos mencionados ocorre passagem de material genético de uma bactéria doadora para uma receptora que incorpora, por recombinação, o DNA recebido ao seu patrimônio genético. Em consequência, uma bactéria pode passar a revelar uma ou mais características que não possuía antes. Assim sendo, a recombinação, por quaisquer desses processos, mantém, nas bactérias, uma variabilidade genética que compensa a ausência da meiose e da fecundação, levando a que elas tenham maiores chances de se adaptar a ambientes diferentes. A engenharia genética ou tecnologia do DNA recombinante (ver CLONAGEM GÊNICA, matéria publicada neste blog em 26/02/2011) também promove recombinação genética nesses organismos. As mutações (ver MUTAÇÃO GÊNICA, matéria publicada neste blog no dia 15/04/2011), base do processo evolutivo, podem, igualmente, contribuir para a diversidade genética de uma população.

Nesta publicação, veremos apenas a transformação bacteriana. A transdução e a conjugação serão abordadas em outra oportunidade.

A transformação bacteriana, que foi descoberta experimentalmente, é a absorção e a posterior incorporação de fragmentos de DNA dispersos no meio ambiente (figura a seguir), oriundos da lise celular, na maioria dos casos, ou de secreção realizada por bactérias ainda vivas. Havendo compatibilidade entre as linhagens participantes, o fragmento de DNA proveniente da célula denominada doadora passa a compor o material genético da célula receptora, que duplicado é transmitido aos descendentes durante a cissiparidade [ver PLASMÍDEOS (PLAMÍDEO F), matéria publicada neste blog em 04/06/2013].  Neste caso, a bactéria receptora passa a exibir novas características genéticas, condicionadas pelo DNA incorporado.

01

A ocorrência de transformação não requer, necessariamente, que as cepas participantes sejam da mesma espécie, podendo, em princípio, ocorrer entre diferentes espécies. É preciso, acima de tudo, que a célula seja competente, isto é, possua sítios de superfície para a ligação do DNA da célula doadora e apresente a membrana em uma condição que permita a passagem desse ácido nucleico. É necessário, também, que haja certa semelhança entre o DNA introduzido e o DNA da cepa receptora. O estabelecimento da competência é um fenômeno controlado, envolvendo a participação de diferentes proteínas (proteínas de ligação ao DNA, presente na membrana), sendo um processo variável entre os microrganismos. Dentro da bactéria, o DNA estranho pode se unir ao “cromossomo” ou substituir um segmento dele, condicionando novas características genéticas à população bacteriana, denominada população transformada. O DNA que penetra na bactéria, entretanto, pode ser reconhecido como estranho e destruído pelas enzimas de restrição, cuja função é defender a bactéria contra bacteriófagos invasores, degradando o DNA fágico [ver CLONAGEM GÊNICA (ENDONUCLEASE DE RESTRIÇÃO), matéria publicada neste blog em 26/02/2011].

Como se pode verificar na figura abaixo, a transformação bacteriana é semelhante ao “crossing-over” (permuta) que ocorre por ocasião da meiose dos eucariotos.

02.EU

Em função de a transformação bacteriana requerer proteínas de superfície específicas, presentes na cepa receptora, que reconhecem e transportam o DNA, nem todas as bactérias são capazes de serem transformadas. A transformação requer, portanto, uma compatibilidade entre as bactérias doadoras e as receptoras, não se verificando, indiscriminadamente, entre quaisquer bactérias. Assim sendo,bactérias capazes de realizar esse processo são descritas como competentes. A transformação tem sido bastante útil no mapeamento de genes de bactérias competentes, como a Bacillus subtilis, que também captam, eficientemente, o DNA através de outras formas de recombinação, como a transdução [transferência indireta e horizontal de segmentos da molécula de DNA de uma bactéria (doadora) para outra (receptora) por meio de um bacteriófago ou fago (vírus bacteriano), que funciona como um vetor.] Em verdade, são poucas as bactérias dotadas da propriedade de captar DNA do meio com facilidade. O mapeamento, com transformação, foi utilizado para demonstrar que o “cromossomo” da B. subtilis, da mesma forma que de todos os procariontes, consiste em uma molécula de DNA circular (ver PLASMÍDEOS, matéria publicada neste blog em 04/06/2013).

O experimento clássico que mostrou a ocorrência de transformação bacteriana teve seu início em 1928 com o inglês Fred Griffith e foi concluído em 1944 pelos pesquisadores Oswald T. Avery, Colin M. MacLeod e Maclyn McCarty, no Instituto Rockefeller, nos EUA. Nos trabalhos foi utilizada a bactéria Diplococcus pneumoniae, causadora de pneumonia. A série de trabalhos realizados mostrou que o DNA extraído de uma variedade “virulenta” (causadora de doença) da D. pneumoniae transformava, geneticamente, uma linhagem “não virulenta” (não patogênica) desse organismo, em uma forma “virulenta” (patogênica) [ver DNA: DEPÓSITO DAS INFORMAÇÕES GENÉTICAS (PRIMEIRA EVIDÊNCIA EXPERIMENTAL - PRINCÍPIO TRANSFORMANTE), matéria publicada neste blog em 10/07/2011]. A pesquisa se constituiu, também, na primeira evidência experimental que o DNA era o material genético.

A transformação bacteriana tem sido utilizada pelos cientistas para introduzir genes de espécies diferentes em células bacterianas hospedeiras, como no caso do gene da insulina humana que foi introduzido em célula de Escherichia coli que se tornou capaz de sintetizar esse hormônio. A insulina foi, inclusive, a primeira proteína humana produzida através dessa tecnologia em bactérias e aprovada para uso em humanos (ver CLONAGEM GÊNICA, matéria publicada neste blog em 26/02/2011).

Publicado por: Djalma Santos | 26 de fevereiro de 2014

Testes de citologia geral (1)

01. (UNIOESTE) Referente às células animal e vegetal, considere as colunas I e II e assinale a associação correta.

I

II

1. Proteção da célula contra danos mecânicos e químicos. a. Citoesqueleto.
2. Presente entre células epiteliais, ricos em queratina. b. Glicocálix.
3. Estruturas ricas em microfilamentos contráteis. c. Microvilosidades.
4. Ajuda a manter a forma da célula e auxilia em movimentos celulares. d. Desmossomos.
5. Estrutura constituída de duas subunidades livres de membranas.

e. Aparelho de Golgi.

6. Formação do acrossomo do espermatozoide e da lamela média dos vegetais. f. Lisossomos.
7. Estruturas responsáveis pela autofagia e autólise celular. g. Ribossomos.

 a) 1d, 2c, 3e, 4g, 5b, 6f, 7a.

b) 1d, 2c, 3a, 4b, 5f, 6g, 7e.

c) 1a, 2b, 3f, 4e, 5c, 6d, 7g.

d) 1b, 2d, 3c, 4a, 5g, 6e, 7f.

e) 1c, 2f, 3e, 4g, 5a, 6d, 7b.

02. (UEM) Sabe-se que todos os seres vivos são formados por unidades básicas denominadas células. Em relação a essas unidades estruturais e funcionais dos seres vivos, assinale o que for correto.

I   II

0  0 – Na célula eucariótica, os cromossomos estão no interior de um envoltório membranoso, composto por duas membranas.

1  1 – Nas células, quando uma proteína vai ser sintetizada, uma região do DNA do núcleo da célula é copiada por uma enzima chamada RNA polimerase.

2  2 – Núcleo, mitocôndrias e cloroplastos são as únicas estruturas celulares que possuem DNA.

3  3 – A retirada do nucléolo de uma célula implicará na intensa síntese de ribossomos.

4 4 – Nas células, a água atravessa a membrana celular por difusão facilitada, pois sua molécula é polar e as moléculas de lipídios formam uma camada interna hidrofóbica.

03. (FCM-PB) O caminho de uma proteína desde a sua síntese até a membrana plasmática é:

a) Reticulo endoplasmático liso, vesícula de secreção, Complexo de Golgi, vesícula de transição e endossomo.

b) Reticulo endoplasmático rugoso, vesícula de transição, Complexo de Golgi e membrana.

c) Reticulo endoplasmático liso, vesícula de pinocitose, Complexo de Golgi, vesícula de transição e membrana.

d) Reticulo endoplasmático rugoso, vesícula de transição, Complexo de Golgi, vesícula de secreção e membrana.

e) Retículo endoplasmático liso, Complexo de Golgi, pinocitose, membrana.

04. (MACKENZIE) Em comum, as células de cianobactérias, algas e plantas têm:

a) Parede celulósica.

b) Pigmento clorofila.

c) Cloroplasto.

d) Núcleo organizado.

e) Pigmentos carotenoides.

05. (UNIOESTE) Em relação às diversas estruturas celulares, pode-se afirmar que:

I   II

0  0 – O retículo endoplasmático é responsável pela produção de vesículas lisossômicas.

1  1 – O fuso acromático é originado pelo núcleo, na interfase.

2  2 – O complexo de Golgi encarrega-se da síntese de ácidos nucleicos.

3  3 – As mitocôndrias proporcionam um conjunto de reações que constituem o ciclo de Krebs.

4  4 – Cloroplastos e mitocôndrias apresentam ribossomos e DNA próprios.

06. (FATEC) A tabela a seguir apresenta características relacionadas com a presença (+) ou ausência (–) de algumas estru­turas, nas células indicadas pelas letras A, B e C.

06 Assinale a alternativa que associa corretamente cada uma das células (A, B ou C) com um dos seguintes rei­nos: Monera, Protista, Fungi, Plantae e Animalia, considerando as estruturas celulares que os diferenciam.

a) A célula A é característica do reino Plantae, devido à ausência de parede celular e cloroplastos.

b) As células B e C são características do reino Protista, devido principalmente à presença de parede celular e ribossomos.

c) A célula C é característica do Fungi, devido principalmente à ausência de membrana nuclear, nucléolo e cloroplastos.

d) As células A e C são características do reino Animalia, devido à ausência dos cloroplastos.

e) A célula C é característica do reino Monera, pois não possui membrana nuclear, ou seja, possui núcleo “desorganizado”.

07. (UEPA)

Leia com atenção o Texto a seguir para responder esta questão.

A pessoa adoece quando, por qualquer razão, as células deixam de se comunicar adequadamente. Em decorrência disso, o estudo da célula, como unidade estrutural e funcional dos seres vivos, que apresenta peculiaridades nos diferentes reinos em relação a sua estrutura, possibilita ao cientista melhor compreensão sobre a origem das doenças, facilitando a pesquisa de novos medicamentos.

Sobre a unidade biológica abordada no texto, leia as afirmativas abaixo:

I. No Reino Monera, o material genético encontra-se envolvido por uma membrana nuclear.

II. No Reino Fungi, apresenta a membrana plasmática envolvida por uma parede quitinosa.

III. No Reino Vegetal, possui como características parede celular constituída de celulose e organela cloroplasto.

IV. No Reino Animal, apresenta-se destituída de celulose.

A alternativa que contém todas as afirmativas corretas é:

a) I, II e III.

b) I, II e IV.

c) I, III e IV.

d) II, III e IV.

e) I, II, III e IV.

08. (UEPG) Considerando-se a organização das células, assinale a alternativa correta.

a) Dentre as diferenças de uma célula animal para uma célula vegetal, pode-se citar a presença exclusiva de parede celular, vacúolos, cloroplastos e mitocôndrias nas células vegetais e a ausência desses componentes, nas células animais.

b) As plantas são classificadas como seres heterotróficos, visto que a célula vegetal é capaz de sintetizar sua própria fonte de energia, a partir da glicose capturada do solo.

c) A maioria das células vegetais possui um grande vacúolo central que tem por função principal armazenar a clorofila, pigmento que dá cor verde aos vegetais.

d) As células vegetais não podem se comunicar umas com as outras, visto que a parede celular é extremamente rígida e impermeável, funcionando como uma barreira à entrada e saída de água e outras substâncias.

e) Os plastos são organelas citoplasmáticas presentes nas células vegetais. Como exemplo, pode-se citar o cloroplasto, organela que apresenta o pigmento clorofila em suas membranas internas, o qual possui a função de captar luz solar.

09. (UEM) Sobre a estrutura e a função dos cromossomos, assinale o que for correto.

I   II

0  0 – A permutação ou crossing-over ocorre na prófase I tanto em vegetais quanto em animais.

1  1 – Depois do desenvolvimento de métodos para sequenciar o DNA, o cariótipo passou a ser denominado genoma.

2  2 – A quantidade de DNA encontrado em uma célula durante a prófase da mitose é a metade do DNA encontrado em cada uma das células-filhas resultantes da divisão.

3  3 – Na espécie humana, os cromossomos denominados autossomos ocorrem tanto no sexo masculino quanto no sexo feminino.

4  4 – O nucléolo faz parte da estrutura dos cromossomos.

10. (UEA) Observe o esquema abaixo, no qual 1 e 2 representam diferentes processos celulares que ocorrem em organelas específicas.

10 Os processos 1 e 2 representam, respectivamente:

a) Transcrição e tradução.

b) Tradução e transcrição.

c) Respiração celular e tradução.

d) Respiração celular e transcrição.

e) Tradução e fermentação.

11. (UCB) Com exceção dos vírus, todos os demais seres têm as suas estruturas fundamentadas na célula. Muitos são apenas unicelulares, outros são multicelulares. Mas, a despeito de algumas diferenças, a arquitetura fundamental da célula se repete com impressionante semelhança em todos os níveis de organização, o que justifica se considerar a célula como a unidade biológica. No que se refere às células, às suas organelas, às funções e ao determinismo genético, julgue os itens a seguir.

I   II

0  0 – Os lisossomos apresentam enzimas hidrolíticas para a digestão intracelular.

1  1 – As células procariontes apresentam núcleo bem individualizado pelo envoltório nuclear.

2  2  – A síntese proteica só acontece se o DNA “determinar” que a célula precisa de proteína naquele instante. Serão necessários, então, dois eventos: a transcrição e a tradução.

3  3  – Adenina, timina, citosina e guanina são as bases nitrogenadas do DNA.

4  4 – A função de secreção está reservada às mitocôndrias.

12. (UEL) Pode-se considerar a organização e o funcionamento de uma célula eucarionte animal de modo análogo ao que ocorre em uma cidade. Desse modo, a membrana plasmática seria o perímetro urbano e o citoplasma, com suas organelas, o espaço urbano. Algumas dessas similaridades funcionais entre a cidade e a célula corresponderiam às vias públicas como sendo o retículo endoplasmático, para o transporte e a distribuição de mercadorias; os supermercados como sendo o complexo de Golgi, responsável pelo armazenamento de mercadorias, e a companhia elétrica como sendo as mitocôndrias, que correspondem à usina de força da cidade. Pode-se, ainda, considerar que a molécula de adenosina tri-fosfato (ATP) seja a moeda circulante para o comércio de mercadorias. Assinale a alternativa que justifica, corretamente, a analogia descrita para as mitocôndrias.

a) Absorção de energia luminosa utilizada na produção de ATP.

b) Armazenamento de ATP produzido da energia de substâncias inorgânicas.

c) Armazenamento de ATP produzido na digestão dos alimentos.

d) Produção de ATP a partir da oxidação de substâncias orgânicas.

e) Produção de ATP a partir da síntese de amido e glicogênio.

13. (UEM) Sobre as estruturas e as funções celulares, assinale o que for correto.

I   II

0  0 – A fermentação é um processo de obtenção de energia que é encontrado apenas em organismos eucarióticos.

1  1 – Na célula eucariótica, a síntese do RNA mensageiro ocorre no retículo endoplasmático granular.

2  2 – No interior das células vegetais, as mitocôndrias e os proplastos sempre são originados, respectivamente, de mitocôndrias e de proplastos preexistentes.

3  3 – As cadeias transportadoras de elétrons das mitocôndrias e dos cloroplastos são formadas por proteínas situadas em membranas lipoproteicas.

4  4 – Em relação ao espaço extracelular, no interior da célula, a concentração de íons sódio é de 10 a 15 vezes menor, enquanto a concentração de íons potássio é, aproximadamente, 10 vezes maior. Essas diferenças de concentrações são mantidas pela bomba de sódio e de potássio, que é um processo de transporte ativo que envolve proteínas da membrana plasmática.

14. (Unaerp-SP) Considere as estruturas celulares a seguir, relacione-as com as funções propostas e depois escolha a opção correta.

1. Cromossomos.

2. Nucléolos.

3. Complexo de Golgi.

4. Cloroplastos.

5. Vacúolos.

A. “Produção” de oxigênio.

B. Regulação osmótica.

C. Informação genética.

D. Reservatório de RNAr.

E. Formação de lisossomos.

A relação correta é:

a) 1C2E3D4A5B.

b) 1B2C3E4D5A.

c) 1A2B3C4D5E.

d) 1C2D3E4A5B.

e) 1D2C3E4B5A.

15. (UEM) Sobre a estrutura e as funções celulares, assinale o que for correto.

I   II

0  0 – Na célula, há movimentação de proteínas, de carboidratos e de lipídios de uma organela para outra. Essa transferência de moléculas ocorre pelo interior dos microtúbulos, que formam um sistema de canais interligados.

1  1 – A membrana plasmática e todas as membranas encontradas no interior da célula são lipoproteicas.

2  2 – Um aminoácido radioativo foi adicionado ao meio de cultura de células vegetais. As células cultivadas proliferaram e, após várias gerações celulares, todas as proteínas sintetizadas nas células descendentes são radioativas. Mas, como a síntese de proteínas ocorre no citoplasma, as células dessa cultura não apresentarão radioatividade no núcleo.

3  3 – Nas células animais, a síntese de RNA ocorre no núcleo e nas mitocôndrias.

4 4 – Nenhum tipo de bactéria possui mitocôndrias. Portanto nenhuma bactéria utiliza o oxigênio para a respiração.

16. (UFTM) Um homem que não produza as estruturas celulares cílios e flagelos terá maior chance de desenvolver, respectivamente:

a) Infecções nos olhos e esterilidade.

b) Enfisema pulmonar e osteoporose.

c) Conjuntivite e cálculos renais.

d) Problemas respiratórios e infertilidade.

e) Astigmatismo e diabetes.

17. As células interagem intensamente com o ambiente em que estão. Um ser unicelular interage com o meio onde vive, assim como as células de um organismo pluricelular interagem com o líquido existente entre elas. Sobre a interação entre células e o meio circundante, assinale o que for correto.

I   II

0  0 – A pinocitose e a difusão são processos que consomem moléculas de ATP.

1 1 – Alguns protozoários obtêm alimento englobando, por emissão de expansões citoplasmáticas, partículas sólidas presentes no meio. Esse processo é denominado fagocitose.

2 2 – Uma célula animal que sintetiza, armazena e secreta enzimas deve ter bastante desenvolvidos os retículos endoplasmáticos granulosos e os complexos de Golgi.

3  3 – A respiração celular é um processo de oxidação em que o gás oxigênio atua como o último agente oxidante de moléculas orgânicas.

4  4 – Neurônios associativos são aqueles que recebem os estímulos sensoriais do ambiente e conduzem os impulsos nervosos de órgãos dos sentidos e de células sensoriais para o sistema nervoso central.

18. (UEM) Em relação ao funcionamento da célula, assinale a alternativa correta.

a) O citoplasma é uma solução aquosa. A célula perde água através da membrana celular quando mergulhada em solução hipertônica.

b) As proteínas são sintetizadas pelos ribossomos do retículo endoplasmático granuloso e excretadas pelos lisossomos.

c) Quando a célula ingere uma partícula sólida pelo processo da pinocitose, essa partícula é digerida por enzimas liberadas pelos lisossomos.

e) A fotossíntese é um processo realizado pelos cloroplastos que absorvem a luz verde do sol.

e) A eliminação de substâncias da célula se dá sempre pelo complexo de Golgi.

19. (UFJF) Indivíduos que fazem musculação podem apresentar células musculares com nucléolo maior do que o de indivíduos sedentários. Esse fenômeno ocorre porque a musculação aumenta:

a) A necessidade de ribossomos, que têm suas subunidades montadas no nucléolo.

b) A necessidade de glicose, que é ressintetizada no nucléolo.

c) A síntese de proteínas, que ocorre no nucléolo.

d) A produção de ácido lático, que é degradado no nucléolo.

e) O tamanho das células e, consequentemente, aumenta a necessidade de lipídios de membrana, que são sintetizados no nucléolo.

20. (COVEST) As imagens abaixo representam uma célula animal e uma célula vegetal.

20

Com base nessa imagem, analise as proposições apresentadas a seguir.

I    II

0  0 – A imagem A não pode ser representação de célula vegetal, por não apresentar lisossomo.

1   1 – A imagem B certamente representa uma célula animal.

2   2 – A imagem A também representaria bem uma célula bacteriana.

3   3 – A clorofila pode ser encontrada na organela indicada pela letra b.

4  4 – A representação está incorreta, porque a organela indicada pela letra c não ocorre em células vegetais.

GABARITO

01

02

03

04

05

06

07

08

09

10

D

VVVFF

D

B

FFFVV

E

D

E

VFFVF

C

11

12

13

14

15

16

17

18

19

20

VFVVF

D

FFVVV

D

FVFVF

D

FVVVF

A

A

FVFVF

Publicado por: Djalma Santos | 17 de fevereiro de 2014

Testes sobre vírus

01. (IFBA) Na figura abaixo, vê-se que os personagens programam como passarão o verão. Este diálogo é válido para o comportamento dos vírus. Sobre eles, pode-se afirmar:

01

a) Nas viroses humanas, como a sífilis, o tempo de incubação é o período compreendido entre o contágio e o desaparecimento dos sintomas.

b) Os vírus atendem às premissas fundamentais da teoria celular e por isto são considerados seres vivos.

c) Na gripe, o uso de antibióticos contribui para a diminuição dos sintomas e, após, alguns dias, promove a cura definitiva da virose.

d) Na estrutura molecular da maioria dos vírus, o material genético será DNA ou RNA, e estará envolvido por um capsídeo proteico.

e) Na AIDS, o HIV utiliza a transcriptase reversa da célula para produzir uma molécula de RNA a partir do DNA viral.

02. (UECE) A palavra vírus vem do Latim virus que significa fluido venenoso ou toxina. Sobre os vírus biológicos, é correto afirmar-se que:

a) Possuem como material genético exclusivamente o RNA.

b) Sífilis, raiva, tétano, sarampo, dengue, coqueluche e AIDS são todas doenças causadas por vírus.

c) São incapazes de infectar plantas, pois são parasitas exclusivos de animais.

d) São seres que não manifestam atividade biológica fora de células hospedeiras.

03. (PUC-CAMPINAS)

Atenção: Para responder esta questão considere o texto apresentado abaixo.

(…) pelo menos 1,1 milhão de brasileiros trabalham no período noturno em centros urbanos e estão sujeitos a problemas de memória, obesidade, falta de sono e enfraquecimento do sistema imunológico, entre outros males.

(…) os trabalhadores noturnos perdem aproximadamente cinco anos de vida a cada 15 trabalhados de madrugada. E têm 40% mais chances de desenvolverem transtornos neuropsicológicos, digestivos e cardiovasculares.

(…) nosso organismo precisa descansar durante as noites, quando libera hormônios como a melatonina, o cortisol e o GH (hormônio do crescimento). (…)

Uma das substâncias que dependem muito do escuro e da noite para serem liberadas é a melatonina. O hormônio ajuda a controlar o momento certo de cada função corporal.

                                         (Revista Galileu, outubro de 2010, p. 22)

O trabalho noturno pode enfraquecer o sistema imunológico, mas esse enfraquecimento não é tão agudo quanto o causado pela infecção com o vírus HIV. Nesse último caso, ocorre a morte de um grande número de linfócitos CD4 que controlam e regulam a resposta imunológica, causada pela proliferação viral. Identifique a alternativa que descreve corretamente o modo como esse vírus se prolifera no interior das células.

a) Esse é um vírus de DNA cuja replicação ocorre de forma contínua e independente do genoma celular.

b) As moléculas de proteína que formam o capsídeo do vírus são originadas a partir de genes presentes no genoma da célula hospedeira.

c) O HIV é um retrovírus e seu genoma de RNA deve ser convertido em DNA para que possa controlar o metabolismo da célula hospedeira.

d) O vírus é formado por uma única célula procariótica que ao entrar na célula hospedeira encontra o ambiente adequado para sua replicação.

e) Ao entrar na célula, as moléculas de DNA circular que formam o genoma do vírus integram-se ao genoma da célula e passam a controlar seu metabolismo.

04. (UFPel) Não podemos afirmar que os vírus sejam seres vivos, mas hoje sabemos que são estruturas capazes de se multiplicar muito rapidamente, o que só ocorre quando estão no interior de células vivas. Assinale a alternativa que indica o motivo pelo qual os vírus para poder se reproduzir têm que parasitar e destruir uma célula.

a) Porque necessita agregar mais água à sua estrutura e dessa forma atingir sua finalidade reprodutiva.

b) Porque são sempre sapróbios e necessitam agregar ao seu material o da célula parasitada.

c) Porque são partículas orgânicas que necessitam associar-se a outras para formar uma terceira.

d) Porque necessita da estrutura da célula parasitada para se reproduzir.

e) Porque são constituídos de um material genético (ADN ou ARN) envolto por uma capa protetora de aminoácidos.

05. (UDESC) Assinale a alternativa incorreta a respeito das características gerais dos vírus.

a) Muitos vírus são específicos em relação ao hospedeiro; atacam apenas um tipo de célula ou poucos tipos.

b) Os vírus são considerados parasitos intracelulares obrigatórios, pois são capazes de se multiplicar apenas no interior de células hospedeiras.

c) Um vírus é um organismo acelular, constituído basicamente por um capsídeo proteico e por moléculas de DNA e RNA.

d) Infecção viral consiste na penetração do vírus no interior da célula hospedeira.

e) Após a adesão do vírus à membrana plasmática da célula hospedeira, pode haver a entrada de todo o vírus no interior celular ou apenas do seu material genético.

06. (PUC-RS)

RESPONDA ESTA QUESTÃO COM BASE NAS INFORMAÇÕES APRESENTADAS ABAIXO.

Uma planta de alface cultivada em estufa foi infectada por um vírus que causa uma doença. Após algumas semanas, outras plantas de alface próximas a essa estavam também infectadas com esse vírus.

O vírus se multiplicou:

a) Porque matou imediatamente a planta hospedeira, ficando livre para se multiplicar.

b) Porque produziu sementes na alface.

c) Utilizando os recursos e a maquinaria celular do hospedeiro.

d) Porque formou os seus próprios esporos.

e) Por mitose nas células do hospedeiro.

07. (UPE) A pandemia de gripe de 2009 (inicialmente designada como gripe suína e, em abril de 2009, como gripe A) é um surto global de uma variante de gripe suína, cujos primeiros casos ocorreram no México em meados do mês de março de 2009, vindo a espalhar-se pelo mundo. O vírus foi identificado como Influenza A subtipo H1N1, uma variante nova da gripe suína. Os sintomas da doença são o aparecimento repentino de febre, tosse, dor de cabeça intensa, dores musculares e nas articulações, irritação nos olhos e fluxo nasal.

                     Fonte – pt.wikipedia.org/wiki/Gripe_suína

Sobre os vírus, assinale a alternativa correta.

a) Os vírus são organismos acelulares, com metabolismo próprio, formados por uma cápsula de proteínas – o capsídeo.

b) Os vírus contêm, no interior do capsídeo, DNA e RNA. O conjunto formado pelo capsídeo e pelo ácido nucleico é denominado de cápsula proteica.

c) Sua reprodução ocorre no interior da célula hospedeira; fora desta não possuem metabolismo e permanecem inertes, razão por que são denominados parasitas intracelulares obrigatórios.

d) Os novos vírus formados são semelhantes ao original, pois não são capazes de sofrerem mutações.

e) A medida profilática mais eficiente no combate às infecções virais, como a da gripe AH1N1 A, é o uso de antibióticos que estimulam nosso organismo a produzir interferon.

08. (UFT) Vírus são organismos acelulares, ou seja, não apresentam estrutura celular. Com relação aos vírus é correto afirmar:

a) Apresentam duas moléculas de ácido nucleico, DNA e RNA, em sua constituição básica, as quais são protegidas por uma cápsula proteica.

b) São capazes de se reproduzirem de forma independente, ou seja, não necessitam estar infectando outra célula viva.

c) Precisam, necessariamente, estar dentro de uma célula viva para se reproduzirem.

d) Doenças como catapora, sarampo e tuberculose são causadas por vírus.

e) Durante uma infecção viral, a cápsula proteica do vírus também penetra na célula hospedeira juntamente com o material genético.

09. (UECE) Com relação aos vírus, assinale a alternativa correta.

a) São seres que possuem membrana plasmática, envoltório fundamental à proteção do seu material genético interno.

b) São autossuficientes, uma vez que sintetizam ácidos nucléicos e proteínas indispensáveis à sua reprodução.

c) Por apresentarem metabolismo próprio, são microrganismos bastante patogênicos, capazes de causar epidemias que afetam diretamente à espécie humana.

d) Apresentam apenas um tipo de ácido nucleico que, dependendo do vírus, pode ser o DNA ou o RNA.

10. (MACK) O ser humano tem travado batalhas constantes contra os vírus. A mais recente é contra o vírus H1N1, que causa a “gripe suína”. A respeito dos vírus, assinale a alternativa correta.

a) São todos endoparasitas celulares.

b) Os antibióticos só são eficazes contra alguns tipos.

c) Todos eles possuem o DNA e o RNA como material genético.

d) Atualmente existem vacinas contra todos os tipos.

e) Alguns deles possuem reprodução sexuada.

11. (COVEST) A gripe causada pelo Influenza A H1N1 tem provocado uma pandemia sem precedentes, com gravidade somente comparada à gripe espanhola do início do século passado. Sobre estes vírus, observe a figura abaixo e considere as afirmações que se seguem.

11

I  II

0 0 – Os vírus Influenza se ligam às células alvo por meio de espículas (1), que também são utilizadas para diferenciar os tipos de Influenza.

1 1 – Após a entrada na célula, o nucleocapsídeo deposita no núcleo celular o material genético

de RNA (2), que é replicado (3) e transcrito em RNAm (4).

2 2 – O RNAm é traduzido (5) em proteínas das espículas (6) e enzimas, dentre estas, a transcriptase reversa que volta ao núcleo celular (7) para sintetizar DNA viral.

3  3 – A probabilidade é que a disseminação desses vírus seja ainda maior nos períodos de inverno da América do Norte e da Europa.

4 4 – As vacinas produzidas contra o vírus da gripe são geralmente pouco eficientes devido à variação antigênica das espículas H (hemaglutinina) e N (neuraminidase), o que dificulta o reconhecimento dos vírus pelos anticorpos. 

12. (UFAL) O HIV (sigla de Human Immunodeficiency Virus – vírus da imunodeficiência humana) é o agente causador da AIDS (sigla da expressão inglesa Acquired Immunodeficiency Syndrome – Síndrome da Imunodeficiência Adquirida). O HIV ataca principalmente determinadas células do sangue, sobretudo os linfócitos T auxiliadores (células CD4), que comandam todo o sistema de defesa contra as infecções.

12

Sobre os vírus, podemos afirmar, exceto:

a) Diferem de todos os seres vivos por serem acelulares.

b) São constituídos principalmente por duas classes de substâncias químicas: proteínas e ácidos nucleicos, que pode ser DNA (ácido desoxirribonucleico) ou RNA (ácido ribonucleico).

c) São considerados parasitas intracelulares obrigatórios.

d) O HIV contém a enzima transcriptase reversa que permite produzir moléculas de DNA a partir das moléculas de RNA, exatamente ao contrário do que costuma ocorrer nas células.

e) Além do DNA cromossômico, os vírus também podem conter pequenas moléculas circulares adicionais de DNA – os plasmídios.

13. (UEPA) A partir de meados de abril deste ano os meios de comunicação deram ênfase a uma nova gripe que, segundo a Organização Mundial de Saúde (OMS), foi considerada uma pandemia. Trata-se da gripe “A”, também conhecida como “gripe suína”, uma vez que seu agente causador é um vírus que foi isolado pela primeira vez num porco, em 1930.

                                       Fonte: texto criado com informações do artigo Vírus da gripe suína foi isolado pela 1ª vez em 1930, estadão.com.br de 27/04/2009. http://www.estadao.com.br/noticias

Quanto à palavra em destaque, no texto acima, é correto afirmar que:

I. São morfologicamente simples, formados por uma cápsula proteica, que envolve o material genético.

II. O HIV e o vírus da gripe são retrovírus que contêm uma cadeia simples de DNA associada à transcriptase reversa.

III. A reprodução do bacteriófago ocorre somente através do ciclo lítico, na bactéria lisogênica.

IV. No caso da hepatite B podem ser transmitidos pelo sangue, saliva, leite materno e sêmen contaminados.

V. Transmitida por um inseto, a Arbovirose dengue, em uma de suas variedades, pode ocasionar hemorragias que, nos casos mais graves, levam à morte.

De acordo com as afirmativas acima, a alternativa correta é:

a) I, II e IV.

b) I, IV e V.

c) II, III e IV.

d) II, IV e V.

e) I, II, III, IV e V.

14. (UNIMONTES) Um novo vírus está causando preocupação para a população mundial: o Vírus H1N1, causador da chamada gripe suína que, até o mês de abril/2009, provocou cerca de 60 mortes no México. Esse vírus apresenta características das gripes suína, aviária e humana. A figura abaixo ilustra o desenvolvimento desse tipo de vírus. Analise-a.

14

Considerando a figura e o assunto abordado, analise as afirmativas abaixo e assinale a alternativa correta.

a) A membrana nuclear viral é eliminada durante a replicação.

b) A fase de desnudamento viral é essencial para formação do novo vírus.

c) A troca de material genético entre os vírus independe da célula hospedeira.

d) Os vírus envolvidos apresentam tropismos celulares distintos.

15.  (UNIFEI) Todos os vírus apresentam a seguinte característica:

a) Reprodução somente no interior de células.

b) Patogenicidade ao homem.

c) Capacidade de infectar e destruir células bacterianas (bacteriófagos).

d) Tamanho que permite observação ao microscópio óptico.

16. (URCA) Alguns vírus como os da gripe são capsulados por possuírem um envoltório externo específico formado por:

a) Proteínas e carboidratos.

b) Glicina e lipídios.

c) Aminoácidos e fosfolipídios.

d) Esterídeos e proteínas.

e) Proteínas e lipídios.

17. (UFPel) Quando os vírus da Influenza de diferentes espécies infectam simultaneamente o mesmo animal (como por exemplo, o suíno), podem reorganizar-se geneticamente e originar uma nova estirpe de vírus, tal como aconteceu atualmente com a emergência deste novo vírus circulante, Influenza A/H1N1. A análise desse vírus sugere que ele tem uma combinação de características das gripes suína, aviária e humana. Especificamente, esta combinação não havia sido vista até agora em humanos ou em suínos, e a sua origem é ainda desconhecida. Mas, felizmente, a conclusão inicial é a de que o vírus se espalha mais facilmente entre os porcos, e o contágio de humano para humano não é tão frequente e simples quanto o da gripe comum.

http://pt.wikipedia.org/wiki/Gripe_su%C3%ADna acessado dia 10/06/2009 às 10:31h

Com base em seus conhecimentos e no texto, é correto afirmar que o vírus Influenza A/H1N1:

a) Não é capaz de se reproduzir sem estar dentro de uma célula hospedeira, portanto são considerados parasitas intracelulares obrigatórios.

b) Foi resultado da combinação de DNA de diferentes vírus Influenza encontrados em três espécies animais, por isso pode ser considerado um híbrido natural.

c) Assim como os demais vírus, é formado somente pelo ácido nucleico (DNA) envolto pela cápsula proteica. Nesse vírus, o ácido nucleico é de origem suína.

d) É um tipo especial de bacteriófago, formado por uma molécula de RNA e o nucleocapsídeo. Por ser um bacteriófago, ele tem um maior índice de contaminação.

e) É transmitido principalmente pela ingestão da carne de porco mal cozida, por isso deve-se evitar esse tipo de alimento neste período de pandemia.

18. (UFRR) O vírus do dengue possui o material genético formado por uma única molécula de ácido ribonucleico (RNA). São conhecidos quatro sorotipos do vírus do dengue, VDEN1, VDEN2, VDEN3, VDEN4, muito relacionados, porém antigenicamente diferentes, pelo que pessoas vivendo em área endêmica, como Roraima, podem ter até quatro infecções durante sua vida. Dentre as alternativas abaixo, é correto afirmar que:

a) A capacidade de reprodução em células hospedeiras sem sofrerem mutação permitiu a existência de quatro sorotipos.

b) Os quatro sorotipos do vírus do dengue possuem a mesma sequência de bases nitrogenadas no seu RNA.

c) O vírus do dengue precisa de células hospedeiras para se reproduzir.

d) As proteínas do vírus do dengue não induzem no organismo à produção de anticorpos.

e) O vírus do dengue apresenta quatro sorotipos por não apresentar capsídeo nem envoltório nuclear.

19. (UEMS) O vírus da imunodeficiência humana (HIV) é o causador da síndrome da imunodeficiência adquirida (AIDS). Em relação a esse vírus, pode-se afirmar que ele é constituído de:

a) DNA e ataca os linfócitos T.

b) RNA e ataca os linfócitos T.

c) RNA e ataca as hemácias.

d) DNA e ataca as hemácias.

e) RNA e ataca as plaquetas.

20. (UEL) O vírus da imunodeficiência humana (HIV) infecta células do sistema imune e é o agente etiológico da AIDS. São características do vírus HIV:

I. Genoma constituído de RNA; presença da enzima transcriptase reversa.

II. Presença de membrana citoplasmática; genoma constituído de DNA.

III. Tropismos por células CD4; transmissão via sexual e via sangue contaminado.

IV. Presença de ribossomos 80S; genoma constituído de RNA e DNA.

Assinale a alternativa correta.

a) Somente as afirmativas I e III são corretas.

b) Somente as afirmativas I e IV são corretas.

c) Somente as afirmativas II e IV são corretas.

d) Somente as afirmativas I, II e III são corretas.

e) Somente as afirmativas II, III e IV são corretas.

21. (UFBA) Penso que a vida resulta da combinação de quatro processos – metabolismo, compartimentação, memória e manipulação – e de uma lei de correspondência entre memória e manipulação. Se tomarmos isso como definição, os vírus não podem ser considerados seres vivos, pois não têm nem metabolismo nem lei de correspondência.

                         (Antoine Danchin apud CIÊNCIA HOJE, 1996. p. 25)

A confrontação do conceito de vida expresso anteriormente com características exibidas pelos vírus permite afirmar:

I   II

0  0 – Os vírus e os seres vivos compartilham uma mesma linguagem na construção de seus genomas.

1   1 – Os vírus obtêm energia usando os mesmos processos bioenergéticos celulares.

2  2 – A organização  molecular  dos vírus expressa  a exigência de proteção para o material genético e de reconhecimento pela célula hospedeira.

3  3 – A universalidade do DNA como material genético, entre os vírus, os aproxima da condição biológica.

4   4 – A capacidade de evoluir é uma propriedade comum aos vírus e aos seres vivos.

22. (UFPB) A figura, a seguir, mostra dois bacteriófagos (T2 e T4).

22

Adaptada de: LOPES, S. BIO. v. 2. 1. ed. São Paulo: Saraiva, 2006, p. 55.

Em um laboratório, foram construídas, experimentalmente, novas partículas virais, utilizando DNA extraído de bacteriófagos T2 e cápsula proteica de bacteriófagos T4. Esses vírus foram postos em contato com bactérias e, após infectá-las, originaram-se novas partículas virais, liberadas após a lise celular (ciclo lítico). De acordo com o ciclo de replicação mencionado e conforme a condução do experimento é correto afirmar que os novos bacteriófagos formados possuirão:

a) Cápsula proteica de T4 e molécula de DNA de T4.

b) Cápsula proteica de T2 e molécula de DNA de T2.

c) Cápsula proteica de T4 e molécula de DNA de T2.

d) Cápsula proteica de T2 e molécula de DNA de T4.

e) Cápsula proteica de T4 e molécula de DNA da bactéria hospedeira.

23. (UEPB) Sobre os vírus, podemos afirmar que:

a) A transmissão dos vírus das plantas ocorre exclusivamente por difusão mecânica, ou seja, quando uma pessoa manipula uma planta infectada e a seguir uma sadia.

b) São estruturalmente simples, sendo formados por uma ou mais cápsulas proteicas, que envolvem o DNA e o RNA, compondo o nucleocapsídeo. Alguns vírus apresentam ainda um envoltório externo ao nucleocapsídeo denominado envelope.

c) Se reproduzem sempre no interior de uma célula hospedeira, exceto os bacteriófagos, por terem dois tipos de ciclos de replicação: o ciclo lítico e o ciclo lisogênico.

d) A infecção viral é específica, sendo essa especificidade decorrência do fato de que para um vírus penetrar em uma célula deve haver uma interação das proteínas virais com as proteínas receptoras existentes na membrana plasmática das células.

e) Os retrovírus podem apresentar DNA ou RNA, mas obrigatoriamente apresentam a transcriptase reversa.

24. (UFRN) Apesar de não saber que a raiva era causada por um vírus, Pasteur realizou vários experimentos para desenvolver uma vacina contra essa doença. No experimento inicial, que não deu certo, ele recolheu saliva de cães infectados e a inoculou em um recipiente de vidro (balão) contendo meio de cultura (água e nutrientes). Esse experimento não deu certo porque o vírus:

a) É um microrganismo envelopado.

b) Intensificou sua virulência.

c) Atenuou sua patogenicidade.

d) É metabolicamente dependente.

25. (UECE) Como resultado das mudanças climáticas, bem como da fragilidade do sistema imunológico decorrente da má alimentação e do uso indiscriminado de medicamentos, observa-se o aumento do número de casos de diversas doenças, dentre elas as viroses. Infecções dessa natureza são causadas por centenas de tipos virais oportunistas. Sobre esses parasitas, marque a opção falsa.

a) O DNA e o RNA sempre ocorrem, simultaneamente, em um mesmo vírus, protegidos dentro do capsídeo.

b) Os vírus são considerados parasitas intracelulares, pois precisam de células vivas para realizar suas atividades metabólicas.

c) Os vírus são parasitas altamente específicos compostos, basicamente, por proteínas e ácidos nucleicos.

d) Ao injetar o material genético no interior das bactérias os fagos bloqueiam a atividade da maioria dos genes destas células.

26. (F. F. O. Diamantina) Um vírus difere de uma bactéria por todas as características abaixo, com exceção de:

a) Ausência de compostos orgânicos.

b) Ausência de metabolismo próprio.

c) Possuir um tipo único de ácido nucleico.

d) Ser obrigatoriamente parasita intracelular.

e) Sua capacidade de cristalização

27. (PUC-RIO) Partículas virais são entidades que são consideradas como seres vivos por alguns autores e por outros como seres não vivos. Assinale a alternativa que contém características que os definem como seres vivos.

a) Presença de material genético e de organização celular.

b) Presença de material genético e ausência de organização celular.

c) Ausência de material genético e de metabolismo.

d) Ausência de material genético e de organização celular.

e) Presença de material genético e capacidade de evolução.

28. (UEPB) Os vírus já foram chamados de “inimigos públicos no 1” dos seres humanos. Essa afirmação é compreensível, se considerarmos as inúmeras doenças que eles podem provocar em nosso organismo e os grandes danos que causam à agricultura e à pecuária, parasitando plantas cultivadas e animais de criação. Apresentam, no entanto, uma elevada especificidade de hospedeiros, que vem sendo pesquisada e utilizada a favor dos interesses humanos. Assim, várias espécies de vírus são atualmente utilizados:

a) Na agricultura – devido à ação decompositora, fertilizando o solo.

b) No emprego laboratorial – fabricação de antibióticos.

c) No manejo biológico – controlando as populações de agentes patogênicos na agricultura.

d) No manejo biológico – combatendo parasitoses humanas.

e) No emprego industrial – fabricação de vinagre e derivados do leite.

29. (UEPB) Sobre os vírus, podemos afirmar que:

a) A dengue, o sarampo, a hepatite, a cólera e a gripe, são doenças causadas por eles.

b) São seres vivos celulares, podendo apresentar DNA ou RNA.

c) Alguns apresentam um envoltório externo ao capsídeo chamado de envelope, geralmente composto por lipídios e glicoproteínas sintetizados pelo próprio vírus.

d) Aqueles que apresentam em sua estrutura a transcriptase reversa, enzima capaz de realizar síntese de DNA utilizando como molde o RNA viral, são chamados de retrovírus, a exemplo do HIV, o vírus da gripe e o do sarampo.

e) São estruturalmente simples, apresentando uma capa proteica – o capsídeo, que envolve a molécula de ácido nucleico, que pode ser DNA ou RNA.

30. (PUC-PR) Vírus é uma “entidade biológica” que pode infectar organismos vivos. Vírus são parasitas intracelulares obrigatórios e isso significa que eles somente se reproduzem pela invasão e controle da maquinaria de auto-reprodução celular. O termo VÍRUS geralmente se refere às partículas que infectam eucariontes, enquanto o termo FAGO é utilizado para descrever aqueles que infectam procariontes. Tipicamente, estas partículas carregam uma pequena quantidade de ácido nucleico cercada por alguma estrutura protetora consistente de proteína também conhecida como envelope viral ou capsídeo; ou feita de proteína e lipídio. São conhecidas aproximadamente 3.600 espécies de vírus, sendo que algumas são patogênicas para o homem. Analise as proposições sobre os vírus e assinale a(s) correta(s):

I    II

0  0 – Vírus com a enzima transcriptase reversa são possuidores de RNA como material genético e são capazes de promover cópias de moléculas DNA a partir de moléculas de RNA.

1  1 – Febre amarela, dengue, varíola, poliomielite, hepatite, hanseníase, Aids, condiloma, sarampo, sífilis e caxumba são exemplos de viroses humanas.

2  2 – Há vírus bacteriófagos capazes de realizar o ciclo lítico onde a célula infectada não sofre alterações metabólicas e acaba gerando duas células filhas infectadas.

3  3 – Antibióticos como a penicilina, cefalexina e ampicilina não são indicados para o tratamento de viroses pois os vírus, devido a sua elevada capacidade mutagênica, desenvolvem rapidamente resistência a esses medicamentos.

4  4 – Normalmente, os vírus apresentam especificidade em relação ao tipo de célula que parasitam. Assim, o vírus da hepatite tem especificidade pelas células hepáticas; os vírus causadores de verrugas têm especificidade por células epiteliais; assim como os vírus que atacam animais são inócuos em vegetais e vice-versa.

31. (UFPB) A febre aftosa, a dengue e a AIDS são doenças que atualmente afetam o homem e causam sérios problemas econômicos. Com relação aos organismos causadores dessas doenças, pode-se afirmar que:

I. São bactérias patogênicas contaminadas com bacteriófagos que possuem como tipo de reprodução o ciclo lítico.

II. O material genético destes organismos pode ser DNA ou RNA. No caso da AIDS é um RNA, possuindo uma enzima denominada de transcriptase reversa que transcreve uma molécula de DNA a partir do seu RNA.

III. São parasitas intracelulares obrigatórios, ou seja, precisam de células hospedeiras para utilizar sua maquinaria bioquímica, a fim de fazer funcionar seu programa genético.

Está(ão) correta(s) apenas

a) I e II.

b) I e III.

c) II e III.

d) III.

e) II.

32. (FUVEST) Um argumento correto que pode ser usado para apoiar a ideia de que os vírus são seres vivos é o de que eles:

a) Não dependem do hospedeiro para a reprodução.

b) Possuem número de genes semelhante ao dos organismos multicelulares.

c) Utilizam o mesmo código genético das outras formas de vida.

d) Sintetizam carboidratos e lipídios, independentemente do hospedeiro.

e) Sintetizam suas proteínas independentemente do hospedeiro.

33. (UFTPR) Em 25 anos o HIV matou 25 milhões de pessoas e está presente em outros 40 milhões. É a segunda doença infecciosa que mais faz vítimas no mundo, logo atrás da tuberculose. Em 2005, 3 milhões de pessoas morreram devido a AIDS; dessas vítimas, 570 mil eram crianças. Dentre as características biológicas citadas a seguir a única que pode ser encontrada no vírus da AIDS é:

a) Parede celular formada por substâncias mucocomplexas.

b) DNA de fita simples.

c) Enzima especial, a transcriptase reversa, para produzir DNA.

d) Membrana externa lipoproteica.

e) Pequenos anéis de DNA, os plasmídeos, dispersos no capsídeo.

34. (UEMS) Componente que faz parte da estrutura dos vírus, formado por proteínas que, além de proteger o ácido nucleico viral, tem a capacidade de se combinar quimicamente com substâncias presentes na superfície das células hospedeiras, permitindo ao vírus reconhecer e atacar o tipo de célula adequado a hospedá-lo:

a) Núcleo viral.

b) Envoltório lipídico.

c) Capsídeo.

d) DNA.

e) RNA.

35. (FUVEST) Os vírus:

a) Possuem genes para os três tipos de RNA (ribossômico, mensageiro e transportador), pois utilizam apenas aminoácidos e energia das células hospedeiras.

b) Possuem genes apenas para RNA ribossômico e para RNA mensageiro, pois utilizam RNA transportador da célula hospedeira.

c) Possuem genes apenas para RNA mensageiro e para RNA transportador, pois utilizam ribossomos da célula hospedeira.

d) Possuem genes apenas para RNA mensageiro, pois utilizam ribossomos e RNA transportador da célula hospedeira.

e) Não possuem genes para qualquer um dos três tipos de RNA, pois utilizam toda a maquinaria de síntese de proteínas da célula hospedeira.

36. (PUC-SP) Entre as afirmações abaixo, relativas aos vírus, assinale a errada.

a) Possuem ribossomos e mitocôndrias essenciais ao seu metabolismo e reprodução.

b) “Reproduzem-se” somente quando no interior de células vivas.

c) Seu material hereditário é constituído por DNA ou RNA.

d) São agentes etiológicos de várias doenças humanas.

e) Possuem uma cápsula externa constituída, principalmente, por proteínas.

37. (UFPB) Geralmente o grupo de células que um tipo de vírus infecta é bastante restrito e está relacionado à interação existente entre as moléculas de proteínas receptoras específicas, presentes na superfície da célula a ser infectada, e as(o):

a) Proteínas virais.

b) DNA viral.

c) Ácido nucleico viral.

d) Camadas de lipídeos do envelope viral.

e) Substâncias químicas específicas produzidas pelo vírus antes da infecção.

38. (UFC) Os vírus são entidades que se diferenciam de todos os organismos vivos por serem acelulares não tendo, assim, a complexa maquinaria bioquímica necessária para fazer funcionar seu programa genético precisando, pois, de células que os hospedem. Sobre essas entidades é correto afirmar que:

a) Alguns vírus são parasitas intracelulares obrigatórios, outros não.

b) Cada espécie viral possui mais de um tipo de ácido nucleico.

c) Os vírus não são incluídos em nenhum dos cinco reinos de seres vivos.

d) Os vírus atacam apenas os animais, incluindo o homem.

e) O ataque dos vírus é mais eficientemente combatido com o uso de antibióticos.

39. (FUVEST) Uma dificuldade enfrentada pelos pesquisadores que buscam uma vacina contra o vírus da AIDS deve-se ao fato dele:

a) Não possuir a enzima transcriptase reversa.

b) Alternar seu material genético entre DNA e RNA.

c) Ser um vírus de RNAr, para os quais é impossível fazer vacinas.

d) Ter seu material genético sofrendo constantes mutações.

e) Possuir uma cápsula lipídica que impede a ação da vacina.

40. Com relação aos vírus, é correto afirmar que:

a) Apesar de não serem considerados seres vivos, os vírus possuem uma organela importante: o núcleo, dentro do qual estão inseridas as moléculas de DNA e RNA.

b) A poliomielite, a rubéola e a hanseníase são doenças causadas por vírus.

c) Os vírus são capazes de sofrer mutações, fazendo com que algumas vacinas percam seu efeito de proteção imunológica.

d) Não existe risco de transmissão da AIDS de uma mulher gestante para o feto que carrega em seu útero.

e) As viroses podem ser curadas pelo uso de medicamentos como os antibióticos.

41. (PUC-MG) Vírus têm sido utilizados como veículo para introduzir genes de interesse em células específicas de um animal vivo. Devido à ação terapêutica desses genes, o processo vem sendo denominado de terapia genética. Recentemente, cientistas conseguiram que ratos gorduchos ficassem magrinhos após injetar nos roedores um gene capaz de transformar as células que armazenam gordura, tornando-as capazes de sinalizar para o cérebro do animal a sensação de saciedade. Um gene que controla a proteína leptina foi colocado dentro de um vírus da gripe desativado, o qual, atuando como Cavalo de Tróia, introduziu o gene nos adipócitos dos roedores que, duas semanas depois, estavam comendo 30% menos e seus adipócitos estavam menores e repletos de mitocôndrias

        (Texto parcialmente extraído do “Jornal Folha de S. Paulo” de 10/02/04.)

A utilização de vírus em terapias genéticas, como a descrita acima, é uma realidade nas pesquisas atuais. Assinale a opção incorreta.

a) Genes inseridos no material genético viral podem ser transcritos no interior da célula.

b) Os vírus apresentam código genético diferente do da célula que invadem.

c) Alguns vírus têm a capacidade de inserir seu material genético no genoma da célula hospedeira.

d) É possível torná-los incapazes de se reproduzir no interior da célula infectada.

42. (UNIFESP) Um pesquisador pretende manter uma cultura de células e infectá-las com determinado tipo de vírus, como experimento. Assinale a alternativa que contém a recomendação e a justificativa corretas a serem tomadas como procedimento experimental.

a) É importante garantir que haja partículas virais (vírus) completas. Uma partícula viral completa origina-se diretamente de outra partícula viral pré-existente.

b) Deve-se levar em conta a natureza da célula que será infectada pelo vírus: células animais, vegetais ou bactérias. Protistas e fungos não são hospedeiros de vírus.

c) Deve-se garantir o aporte de energia para as células da cultura na qual os vírus serão inseridos. Essa energia será usada tanto pelas células quanto pelos vírus, já que estes não produzem ATP.

d) Na análise dos dados, é preciso atenção para o ácido nucleico em estudo. Um vírus pode conter mais de uma molécula de DNA: a sua própria e a que codifica para a proteína da cápsula.

e) É necessário escolher células que tenham enzimas capazes de digerir a cápsula proteica do vírus. A partir da digestão dessa cápsula, o ácido nucleico viral é liberado.

43. (UFU) A figura a seguir representa o ciclo vital do vírus da imunodeficiência humana (HIV).

43

Analise as afirmativas a seguir e marque a alternativa correta.

I. De A para B ocorreu o processo de transcrição reversa e, de D para E, o processo de transcrição.

II. As letras A e C indicam moléculas de DNA.

III. O material genético do HIV é envolvido por um capsídeo de lipídios e glicoproteínas, revestido por um envelope de proteínas.

a) I e III são corretas.

b) I e II são corretas.

c) II e III são corretas.

d) Apenas I é correta.

44. (UDESC) Assinale a alternativa correta, a respeito dos retrovírus.

a) São vírus que possuem DNA e RNA, isso explica sua maior virulência; são os causadores da Gripe A.

b) São vírus de RNA. Apresentam a enzima transcriptase reversa que catalisa a produção de moléculas de DNA a partir do RNA da célula parasitada.

c) São vírus de DNA. Apresentam a enzima transcriptase reversa que catalisa a produção de moléculas de RNA a partir do DNA viral.

d) São vírus de RNA. Apresentam a enzima transcriptase reversa que catalisa a produção de moléculas de DNA a partir do RNA viral.

e) São vírus de DNA. Apresentam a enzima transferase inversa que catalisa a produção de cadeias de DNA a partir do RNA da célula parasitada.

45. (UNIFAL)  Os estudos sobre as formas de replicação dos vírus intensificaram-se nos últimos anos, objetivando encontrar meios mais eficientes de prevenção e tratamento de doenças virais nos seres humanos. Tais estudos têm demonstrado que existem diferentes tipos de vírus e diferentes formas de replicação. Os vírus de RNA de cadeia simples podem ser divididos em três tipos básicos, conhecidos como vírus de cadeia positiva, vírus de cadeia negativa e como retrovírus. Com relação aos diferentes tipos de replicação dos vírus, analise as afirmativas abaixo.
I. Os retrovírus contêm cadeias simples de RNA, enzima transcriptase reversa e produzem DNA tendo como modelo o RNA viral.
II. Os vírus de cadeia negativa possuem RNA genômico com as mesmas sequências de bases nitrogenadas dos RNA mensageiros (RNAm) formados. Dessa maneira, moléculas de RNA servem de modelo para a síntese de moléculas de RNA complementares à cadeia molde.
III. Os vírus de cadeia positiva possuem RNA genômico com sequências de bases nitrogenadas complementares às dos RNAm formados. Desta maneira, moléculas de RNA servem de modelo para a síntese do RNAm.
IV. Os retrovírus contêm uma cadeia de RNA dupla hélice que serve de base para a transcrição do DNA necessário à replicação.

Marque a alternativa correta.
a) Somente II e III são corretas.
b) Somente IV é correta.
c) Somente I é correta.
d) Somente I, II e III são corretas.

46. (UFC) Assinale a alternativa que traz, na sequência correta, os termos que preenchem as lacunas do texto a seguir: “os retrovírus, como o HIV, são partículas portadoras de RNA, que possuem a característica especial de ter a enzima …1… e cujo …2… comanda a síntese de …3… . Este último, uma vez formado, passa a comandar a síntese de novas moléculas de …4…, que irão constituir o material genético de novos retrovírus”.

a) 1-transcriptase reversa; 2-DNA; 3-RNA; 4-RNA

b) 1-transcriptase reversa; 2-RNA; 3-DNA; 4-RNA

c) 1-RNA polimerase; 2-DNA; 3-RNA; 4-DNA

d) 1-DNA polimerase; 2-DNA; 3-RNA; 4-RNA

e) 1-DNA ligase; 2-RNA; 3-DNA; 4-RNA

47. (UFPI) Objetivando promover a reprodução de certo vírus fitopatogênico (vírus que causa patologias em plantas), um estudante o incubou em meio de cultura que continha fonte de carbono e nitrogênio. O estudante obteve sucesso na reprodução do vírus?

a) Não, pois o meio de cultura não inclui vitaminas e minerais, necessários para o metabolismo do vírus.

b) Sim, pois com uma fonte de carbono o vírus poderá sintetizar os demais componentes necessários para formar sua cápsula proteica.

c) Sim, pois o meio de cultura inclui todos os nutrientes requeridos pelo metabolismo do vírus.

d) Sim, pois com uma fonte de nitrogênio o vírus poderá sintetizar os demais componentes para formar sua cápsula proteica.

e) Não, pois os vírus são parasitas intracelulares obrigatórios, sem metabolismo próprio e o meio de cultura não inclui células vivas.

48. (UESPI) Observe o ciclo replicativo do bacteriófago abaixo e, em seguida, assinale a alternativa correta.

48

a) O esquema mostra um ciclo lisogênico.

b) Fica evidente que bacteriófagos não precisam do capsídeo dentro da célula para se replicar.

c) O material genético celular não sofre alteração durante o ciclo replicativo do bacteriófago.

d) A célula acima infectada poderia pertencer a um ser humano.

e) Ao fim do ciclo replicativo do bacteriófago, a célula se mantém integra e pode ser infectada novamente.

49. (CESGRANRIO) Entre as características biológicas citadas a seguir, a única pode ser encontrada nos vírus é um:

a) Programa genético específico que permite a “reprodução” de novos seres do mesmo tipo.

b) Processo metabólico que requer compostos nitrogenados e de carbono, incluindo os produzidos pelos autótrofos.

c) Maquinaria biológica que pode utilizar a energia armazenada em sua célula ou obtida dos alimentos.

d) Maquinaria biossintética para a síntese de proteínas.

e) Membrana celular que estabelece um limite e regula as trocas de matéria e energia.

50. (UFV) Impressionados com a notícia do poder arrasador com que o vírus Ebola vem dizimando certa população na África, alguns alunos de um colégio sugeriram medidas radicais para combater o vírus desta terrível doença. Considerando-se que este agente infeccioso apresenta características típicas dos demais vírus, assinale a alternativa que contenha a sugestão mais razoável:

a) Descobrir urgentemente um potente antibiótico que possa destruir a sua membrana nuclear.

b) Alterar o mecanismo enzimático mitocondrial para impedir o seu processo respiratório.

c) Injetar nas pessoas contaminadas uma dose maciça de bacteriófagos para fagocitar o vírus.

d) Cultivar o vírus in vitro, semelhante à cultura de bactérias, para tentar descobrir uma vacina.

e) Impedir, de alguma maneira, a replicação da molécula de ácido nucleico do vírus.

 

GABARITO

01

02

03

04

05

06

07

08

09

10

D

D

C

D

C

C

C

C

D

A

11

12

13

14

15

16

17

18

19

20

VVFVV

E

B

B

A

E

A

C

B

A

21

22

23

24

25

26

27

28

29

30

VFVFV

B

D

D

A

A

E

C

E

VFFFV

31

32

33

34

35

36

37

38

39

40

C

C

C

C

D

A

A

C

D

C

41

42

43

44

45

46

47

48

49

50

B

C

D

D

C

B

E

B

A

E

 

« Newer Posts - Older Posts »

Categorias

Seguir

Obtenha todo post novo entregue na sua caixa de entrada.

Junte-se a 205 outros seguidores