Publicado por: Djalma Santos | 25 de março de 2014

Testes de genética molecular (1)

01. (IFB) A partir da interpretação da figura abaixo, que ilustra esquematicamente o fluxo da informação genética, é correto concluir:

01

a) O DNA celular é construído pela associação de pequenos segmentos de mRNA.

b) O material genético do cromossomo é estruturado em uma cadeia simples e única de nucleotídeos.

c) A cadeia polipeptídica se estabelece no processo de tradução, conforme a sequência polinucleotídica do mRNA.

d) A formação de mRNAs, a partir de pré-mRNAs, é um evento que se inclui na etapa de decodificação da informação gênica.

e) A molécula de mRNA associada aos ribossomos estabelece uma estrutura permanente que garante a síntese contínua de proteínas.

02. (FCM-PB) A vida pode ser definida como um conjunto de reações químicas organizadas de um modo a permitir que esse conjunto se reproduza. Para dar continuidade de uma geração para a seguinte, o DNA tem que ser quimicamente estável e copiado com precisão durante a replicação. A sequência codificadora de um gene é: 5’ – GCGATGCCATCA – 3’.  Qual é a sequencia da fita complementar desta molécula de DNA?

a) 3’ – TACTCCGGTACT – 5’.

b) 3’ – UACTCCGGTCGT – 3’.

c) 5’ – TCCGGTCGTUCT – 3’.

d) 3’ – ACGTGCGGAACT – 5’.

e) 3’ – CGCTACGGTAGT – 5’.

03. (UEG) As proteínas são polímeros de aminoácidos, cuja sequência é determinada geneticamente. Vinte aminoácidos diferentes são codificados por trincas de bases do DNA, conforme determinado pelo código genético. Em relação a esse código, verifica-se que:

a) A combinação de duas bases nitrogenadas em grupos de três resulta em 60 trincas possíveis.

b) O código é degenerado, visto que cada proteína pode ser codificada por uma mesma trinca.

c) Cada polipeptídio tem uma sequência específica de aminoácidos determinada pelo gene.

d) Quatro trincas não codificam aminoácidos, visto que determinam o fim do polipeptídeo.

04. (UCB) Considerando o gene representado abaixo, que produz duas proteínas, uma de 600 aminoácidos e outra de 530 aminoácidos, julgue os itens seguintes.

04

I   II

0  0 – O esquema representa um gene bacteriano.

1  1 – O gene não existe, porque um gene não pode produzir dois tipos de proteína.

2  2 – As regiões codificadoras são os éxons e os introns são não codificadores.

3 3 – Um indivíduo com deleção (perda) de vinte bases no início do éxon 3 produzirá proteína(s) defeituosa(s).

4  4 – Os três éxons possuem segmentos de DNA codificantes e não codificantes.

05. (FATEC) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados por molduras e são utilizadas setas para indicar o sentido das proposições. O mapa conceitual a seguir refere-se à relação entre cromossomos e proteínas, e nele quatro conceitos foram omitidos.

05

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por:

a) RNA, DNA, aminoácidos e nucleotídeos.

b) RNA, DNA, nucleotídeos e aminoácidos.

c) DNA, RNA, nucleotídeos e aminoácidos.

d) DNA, RNA, monossacarídeos e aminoácidos.

e) DNA, RNA, monossacarídeos e nucleotídeos.

06. (FCM-PB) Em 1978, o geneticista norte-americano Walter Gilbert, estudando o processo de transcrição em eucariotos, propôs os termos éxon, para designar as regiões de um gene que são traduzidas em sequencias de aminoácidos, e introns para designar as regiões não traduzidas. No entanto, o RNA primariamente transcrito feito diretamente de um molde de DNA não é a forma biológica final do RNA. Ainda dentro do núcleo a molécula de RNA recém-sintetizada passa por uma série de reações químicas até ser transformada no mRNA que participará da síntese de proteínas. Sobre as etapas de processamento do RNA, antes de atingir a forma funcional das proteínas, podemos afirmar corretamente que:

I   II

0  0 – A enzima RNA polimerase transcreve tanto as regiões dos éxons quanto a dos introns, produzindo uma molécula de mRNA correspondente a toda unidade de transcrição.

1  1 – O splicing significa a remoção dos introns de uma molécula de RNA pré-mensageiro.

2  2 – A molécula de RNA pré-mensageiro é cortada no limite entre os introns e os dois éxons adjacentes, que são imediatamente unidos entre si.

3  3 – A enzima DNA polimerase III transcreve tanto as regiões dos éxons quanto a dos introns, produzindo uma molécula de mRNA correspondente a toda unidade de transcrição.

4  4 – O splicing significa corte e colagem com a remoção dos éxons de uma molécula de RNA pré-mensageiro.

07. (IFMG) Considere a seguinte sequência de DNA:

A A T C G A T T C G C A T G C

Sobre essa sequência, são feitas as seguintes afirmações:

I. A sequência da fita de DNA complementar é U U A G C U A A G C G U A C G.

II. São representados cinco códons.

III. A partir da sequência de DNA apresentada, é transcrito o RNA mensageiro com a sequência:

T T A G C T A A G C G T A C G.

IV. Desconsiderando-se os códons de iniciação e de parada, a sequência de DNA apresentada dará origem a um pentapeptídeo.

Estão corretas as afirmativas:

a) I, III.

b) II, IV.

c) I, II, III.

d) I, II, III, IV.

08. (IFB.) As células musculares esqueléticas contêm uma rede de filamentos precisamente alinhados compostos de proteínas contráteis; as células cartilaginosas se tornam rodeadas por uma matriz característica, contendo polissacarídeos e proteínas colágenas, que juntas provêm o suporte mecânico; os eritrócitos se tornam um pacote em forma de disco preenchido com uma única proteína, a hemoglobina, que transporta o oxigênio.

           (Karp, Gerald. Biologia Celular e Molecular: conceitos e experimentos. Tradução de Maria Dalva Cesário, et al. Barueri, SP: Manole, 2005, p. 16)

A especialização da célula, configurada no texto na descrição de alguns tipos celulares, envolve um mecanismo básico comum que se reconhece como a:

a) Aquisição de mecanismos próprios a cada tipo celular para a síntese das proteínas.

b) Diversificação dos modelos de organização da membrana plasmática.

c) Preservação da divisão mitótica com a redução progressiva do volume celular.

d) Transcrição diferencial do gene que amplia o potencial do genoma para a síntese de proteínas.

e) Diversificação do genoma, estabelecido na fecundação, no decorrer do desenvolvimento do organismo.

09. (FCM-PB) Até a década de quarenta, não se conhecia ainda um tratamento adequado, eficaz para os diversos tipos de doenças infecciosas. A partir de então, muitas pesquisas foram realizadas e foram descobertas várias substancias com capacidade de bloquear o crescimento bacteriano. Essas substâncias com efeito antibiótico impossibilitam os ribossomos de realizar sua função. Sabe-se que o efeito imediato desse antibiótico sobre as células bacterianas sensíveis a ele é de impedir a síntese de:

a) ATP.

b) DNA.

c) RNA mensageiro.

d) Lipídios presentes na parede bacteriana.

e) Proteínas.

10.  (CEDERJ) Um grupo de pesquisadores sequenciou o genoma completo de uma determinada bactéria e verificou a presença de 30% de adenina no conteúdo de bases aminadas do DNA. Qual a porcentagem das outras bases aminadas no DNA desta bactéria?

a) Timina 30%, guanina 20% e citosina 20%.

b) Timina 70%, guanina 30% e citosina 70%.

c) Timina 30%, guanina 70% e citosina 70%.

d) Timina 20%, guanina 30% e citosina 20%.

11. (IFMT) Nosso DNA não desbota como um pergaminho antigo, não enferruja no solo, como a espada de um guerreiro morto há muito tempo. Não é erodido pelo vento ou pela chuva, nem reduzido a ruínas por fogo e terremotos. É o viajante de uma terra antiga que mora dentro de todos nós (SYKES, 2003, PL 13). O segmento exclusivo não recombinante do cromossomo Y e o DNA mitocondrial possuem particularidades genéticas que os tornam atraentes para o estudo da história humana. Primeiro, eles são herdados de apenas um dos pais: o cromossomo Y é transmitido pelo espermatozoide apenas para descendentes do sexo masculino e o DNAmt é transmitido por meio do óvulo para filhos e filhas. Em segundo lugar, não trocam genes com segmentos genômicos semelhantes, ou seja, não sofrem recombinação, sendo transmitidos em bloco às gerações seguintes (RINCON, 2009, PG 11-12).

Seguindo esse raciocínio, é possível afirmar que a genética evolutiva auxilia na:

I. Elucidação das origens do homem moderno.

II. Apresentação dos padrões de dispersão das populações humanas.

III. Demonstração dos padrões de diversidade genética das populações humanas.

IV. Possibilidade da constituição genética de uma determinada população.

Está correto o que se afirma em:

a) I e II, apenas.

b) II e III, apenas.

c) I, II e III, apenas.

d) I, II, III e IV.

12. (FCM-PB) James Watson e Francis Crick (1953) esclareceram a estrutura tridimensional da dupla hélice do DNA e postularam que o pareamento específico existentes nas bases nitrogenadas propõe um provável mecanismo de cópia para o material genético. Com base nessas informações, o processo de duplicação do DNA é dito como sendo semiconservativo porque:

a) Os dois filamentos de dupla hélice original se fragmentam e servem de molde para a síntese de novos fragmentos.

b) Um dos filamentos da dupla original serve de cópia para as duas fitas de DNA.

c) A dupla hélice original permanece intacta sendo que uma nova dupla hélice é formada.

d) Os dois filamentos da dupla hélice original se separam e cada um serve como molde para uma nova fita.

e) As fitas da dupla hélice original permutam as suas fitas ou filamentos para servirem de cópias de DNA.

13. (FATEC) Os códons são modelos propostos pelos bioquímicos para representar o código genético. São constituídos por três bases nitrogenadas no RNA, e cada uma delas é representada por uma letra:

A = adenina U = uracila C = citosina G = guanina

O modelo para o códon:

a) Poderia ter duas letras, uma vez que o número de aminoácidos é igual a oito.

b) É universal, porque mais de uma trinca de bases pode codificar um mesmo aminoácido.

c) É degenerado, porque mais de um códon pode codificar um mesmo aminoácido.

d) É específico, porque vários aminoácidos podem ser codificados pelo mesmo códon.

e) É variável, uma vez que aminoácidos diferentes são codificados pelo mesmo códon.

14. (UNIOESTE) Com relação a genes, ácidos nucléicos e o fluxo da informação genética, é correto afirmar:

a) Que a diferença entre as bases púricas e pirimídicas está no número de pontes de hidrogênio, sendo 3 pontes de hidrogênio para as bases púricas e 2 pontes de hidrogênio para as bases pirimídicas.

b) Que a duplicação do DNA é bidirecional e semiconservativa.

c) Que o fluxo da informação genética não ocorre, em circunstância alguma, de RNA para DNA, mas ocorre sempre de DNA para RNA.

d) Que, em eucariotos, os genes são transcritos no citoplasma.

e) Que, composicionalmente, DNA e RNA diferem entre si apenas pela presença das bases nitrogenadas Timina e Uracila, respectivamente.

15. (UEPA)

Leia com atenção o texto para responder esta questão.

Informações sobre nossos ancestrais podem ser desvendadas pela análise do DNA. Esta ferramenta permite distinguir entre os brasileiros, as contribuições genômicas relativas às três raízes ancestrais: europeia, africana e ameríndia.

                   Adaptado de http://cienciahoje.uol.com.br/colunas/derivagenetica/ genealogia-linhagens-ancestrais-e-dna

Sobre a molécula orgânica referida no texto, afirma-se que:

I. É formada por duas cadeias ou fitas de nucleotídeos, uma em torno da outra, formando uma dupla hélice.

II. Ao longo da vida pode ser exposta a diversos fatores externos que podem danificar sua molécula e modificar sua mensagem genética inicial.

III. Em interação com o RNA, ribossomos e outros elementos celulares, promove a síntese de proteínas.

IV. Nos eucariotos é encontrada no núcleo formando os cromossomos.

A alternativa que contém todas as afirmativas corretas é:

a) I, II e III.

b) I, II e IV.

c) I, III e IV.

d) II, III e IV.

e) I, II, III e IV.

16. (UNIOESTE) O esquema a seguir representa o fluxo da informação genética em uma célula eucariótica.

16

Com relação ao esquema acima, é correto afirmar que:

I    II

0   0 – O processo 2 é caracterizado pela adição de aminoácidos pelo ribossomo.

1   1 – 2 representa o processo denominado tradução.

2   2 – 1 e 2 ocorrem no núcleo da célula e 3 ocorre no citoplasma.

3   3 – O processo 1 é apenas semiconservativo e realizado por DNAs polimerases.

4   4 – 1 representa o processo denominado duplicação.

17. (FCM-PB) A maioria das mutações é muito pequena, envolvendo um número de nucleotídeos, ou grande envolvendo cromossomos inteiros. As anomalias nos eucariotos podem ocorrer por:

I. Deleção: perde-se um segmento do cromossomo.

II. Translocação: troca entre dois cromossomos não homólogos, após as quebras de ambos os filamentos de DNA.

III. Poliploidia: presença de três ou mais cópias do genoma por núcleo celular.

IV. Aneuploidia: causada pela não disjunção cromossômica, uma falha dos cromossomos homólogos em se separarem durante a meiose.

São corretas as afirmações:

a) I e III, apenas.

b) II, III e IV, apenas.

c) II e IV, apenas.

d) III e IV, apenas.

e) I, II, III e IV.

18. (CEFET-MG) O DNA apresenta diferentes níveis de condensação, conforme representado na figura.

18

No momento em que o DNA de uma célula somática humana for visualizado no nível “F” de condensação, está ocorrendo o processo de:

a) Síntese de proteínas.

b) Multiplicação celular.

c) Permutação cromossômica.

d) Produção de ácido ribonucleico.

e) Duplicação do material genético.

19. (PUC-RIO) Sobre o processo de replicação do DNA, é incorreto afirmar que:

a) Cada molécula de DNA nova é composta por um filamento antigo e um filamento recém-sintetizado.

b) Não há a necessidade de um primer de RNA para a polimerização do filamento contínuo.

c) A polimerização se processa no sentido 5’→3’.

d) Mais de um tipo de DNA polimerase participa do processo.

e) Esse processo ocorre bidirecionalmente.

20. (FCM-PB) ”Dentre os componentes da cromatina, o DNA é o banco de informações genéticas e vetor para várias gerações celulares (Carvalho, A Célula, 2001).” Sabendo-se que as células procarióticas não possuem material genético individualizado por um envelope nuclear como ocorre com as células eucarióticas, assinale a alternativa correta:

a) Nos seres procarióticos só ocorre o processo de transcrição, não ocorrendo a tradução.

b) O processo de transcrição e de tradução nos seres procarióticos ocorre simultaneamente, enquanto que nos seres eucarióticos a transcrição ocorre no núcleo e a tradução ocorre no citoplasma.

c) Tanto nos seres procarióticos quanto nos seres eucarióticos a transcrição e a tradução ocorrem no citoplasma celular.

d) Tanto nos seres procarióticos quanto nos seres eucarióticos a transcrição e a tradução ocorrem no núcleo da célula.

e) O processo de transcrição e de tradução nos seres eucarióticos ocorre no mesmo local, enquanto que nos seres procarióticos, a transcrição ocorre no núcleo e a tradução ocorre no citoplasma, em tempo e espaços distintos.

21. (CEFET-MG) Analise o gráfico abaixo.

21

A presença de genomas maiores, mas relativamente com menos genes funcionais, representa uma vantagem adaptativa pelo fato de reduzir a:

a) Variabilidade genética.

b) Ocorrência de transcrições.

c) Complexidade do material genético.

d) Vulnerabilidade às mutações deletérias.

e) Frequência dos mecanismos de evolução.

22. (UECE) Uma mutação severa foi identificada numa família humana. As sequências de bases nitrogenadas sem a mutação (normal) e com a mutação (sublinhada e marcada com uma seta) estão representadas no quadro abaixo. Em ambas as sequências, estão em destaque o sítio de início da tradução e a base alterada.

22

Tomando por base o quadro acima, que apresenta uma sequência sem mutação (normal) e uma sequência mutante de uma doença humana severa, assinale a opção que corresponde ao ácido nucleico representado e ao número de aminoácidos codificados pela sequência de bases entre o sítio de início da tradução e a mutação.

a) DNA; 8.

b) DNA; 24.

c) RNA; 8.

d) RNA; 24.

23. (FCM-PB) Um paciente procura o médico e diz que apresenta crises frequentes de faringoamigdalites e costuma se automedicar utilizando sempre o mesmo antibiótico. No entanto, nas últimas vezes, o medicamento não surtiu efeito. O médico explica que uso abusivo e indiscriminado de antibióticos na prática clínica tem efeito seletivo no surgimento de bactérias resistentes e que os mecanismos genéticos envolvidos neste processo são a mutação e a recombinação. Marque a opção correta com relação aos mecanismos de transmissão do material genético em bactérias.

a) A transmissão do material genético ocorre apenas por transdução, o DNA bacteriano é transferido entre células mediado por vírus.

b) A conjugação e a transformação são mecanismos de transmissão do material genético, que exigem contato físico entre células doadoras e receptoras.

c) A transmissão do material genético de uma bactéria para outra ocorre por três mecanismos: conjugação, transformação e transdução.

d) No processo de recombinação gênica conjugação, o DNA livre no meio é adsorvido pela célula bacteriana.

e) A transmissão do material genético ocorre de forma aleatória somente por conjugação.

24.  (UEM) “O recente acidente nuclear no Japão reacendeu a polêmica em torno desse tipo de geração de energia e está causando preocupação entre as populações que vivem próximas as usinas. Mesmo em Angra dos Reis, na Costa Verde Fluminense, onde não existe risco de tsunamis ou terremotos, parte da população está ainda mais aflita com um possível vazamento radioativo nas usinas Angra 1 e 2, criadas na década de 70. Uma possível falha humana ou no reator seria o suficiente para uma tragédia na região, que possui cerca de 200 mil habitantes”. (Texto extraído de < http://jornal.ofluminense.com.br/editorias/cidades/tragedia-no-japao-deixa-angra-dos-reis-na-costaverde-do-rjem-alerta&gt;. Acesso em 13/6/2011).

Com relação à radiação e seus efeitos no organismo humano, assinale o que for correto.

I   II

0  0 – Radiação ionizante é um agente físico que aumenta as taxas de mutação. Entretanto, essas alterações no genoma somente serão transmitidas aos seus descendentes, se ocorrerem nas células germinativas.

1  1 – Em comparação à radiação alfa e beta, a radiação gama tem maior poder de penetração no corpo humano. Por isso, é o tipo de radiação ionizante com maior potencial de provocar mutações no genoma.

2  2 – As mutações desencadeadas pela radiação ocorrem sempre no RNA mensageiro e não no DNA, já que o DNA está protegido deste tipo de mutação por moléculas que reparam as bases nitrogenadas alteradas.

3  3 – As radiações solares UVA e UVB têm baixo poder de penetração em nossa pele e podem causar câncer de pele.

4  4 – Mutações desfavoráveis (ou deletérias) podem ter sua frequência reduzida na população, por meio da seleção natural, enquanto mutações favoráveis (benéficas. ou vantajosas) podem se acumular, resultando em mudanças adaptativas.

25. (ALFENAS)  Uma das características do código genético é ser altamente degenerado. Isto quer dizer que:

a) Mais um aminoácido pode ser codificado pela mesma trinca de bases nitrogenadas.

b) Uma base nitrogenada de uma sequência pode pertencer a duas trincas diferentes.

c) Uma base nitrogenada integra apenas uma trinca.

d) O DNA pode sofrer alterações na composição de suas bases nitrogenadas.

e) Mais de uma trinca de bases nitrogenadas pode codificar um mesmo aminoácido.

26. (FCM-PB) A sequência: 3’ – ATGAGGCCAGCATGA – 5’ em um filamento molde de DNA codifica uma molécula de RNA com qual sequência?

a) 5’ – TACTCCGGTCGTACT – 3’.

b) 5’ – UACUCCGGUCGUACU – 3’.

c) 3” – ATGAGGCCAGCATGA – 5’.

d) 3’ – UAC TCCGGTCGTACT – 3’.

e) 5’ – TUCTCCGGTCGTUCT – 3’.

27. (PUC–RS) Em uma pesquisa, uma fita-dupla de DNA de leveduras foi construída usando-se isótopos pesados. Depois disso, essa fita-dupla passou por um ciclo de replicação, no qual foi permitido que as novas fitas de DNA fossem construídas com isótopos leves. Comparando-se o peso das amostras de DNA antes e depois da replicação, verificou-se que, devido à replicação:

a) Conservativa, preservam-se as fitas-duplas de DNA pesadas e produzem-se novas fitas leves.

b) Conservativa, formam-se novas fitas-duplas de DNA com cadeias leves entremeadas em cadeias pesadas.

c) Dispersiva, produzem-se novas fitas-duplas de DNA com cadeias leves intercaladas em cadeias pesadas.

d) Semiconservativa, as novas fitas-duplas de DNA ficam mais leves que a fita-dupla original.

e) Semiconservativa, formam-se novas fitas-duplas de DNA apenas com cadeias leves.

28. (IFSul) Em nosso planeta, todas as formas de vida têm suas informações genéticas codificadas nas sequências de bases nitrogenadas dos ácidos nucleicos. Analise as informações contidas nas sequências 1 e 2.

Sequência 1

                   TAAGATCCCGAATCGGTCGGCGATTTATCC

Sequência 2

                   ATTCTAGGGCTTAGCCAGCCGCTAAATAGG

De acordo com a análise, afirma-se:

I. As sequências 1 e 2 são complementares no DNA e, juntas, representam um segmento de  molécula de DNA.

II. Na sequência 1, estão representados 30 códons e 10 nucleotídeos

III. Se considerarmos a sequência 1 como molde, o RNAm formado por essa sequência conterá as mesmas bases nitrogenadas da sequência 2, substituindo a timina pelo uracil.

IV. Adenina, guanina, citosina e timina são aminoácidos essenciais, presentes em todos os seres vivos.

Estão corretas apenas:

a) I e III.

b) I, II e III.

c) II, III e IV.

d) II e IV.

29. (IFB) A conversão do ovo em feto e do feto em bebê é uma história biológica envolvendo eventos espetaculares que emergem de inter-relações perfeitamente ajustadas e complexas.

29

Em relação ao componente genético do feto, é correto considerar que:

a) Foi definido no momento da fecundação com a contribuição cromossômica diploide de cada progenitor.

b) Sofre modificações no decorrer do desenvolvimento por perdas e substituições de genes no processo de diferenciação das células.

c) Possui quantidades variáveis de genes paternos e maternos.

d) Obtém a especialização celular pelo processamento diferenciado dos mRNAs em função do ambiente celular.

e) É traduzido sob um código genético que é diferenciado para cada tecido.

30. (FCM-PB) A figura abaixo representa um dos fenômenos biológicos altamente especializados e com uma sofisticação invejável, a síntese proteica.

30

As letras A, B, C, D e E, representam respectivamente:

a) Ribossomos, RNAt, RNAm, polissacarídeos, monossacarídeos.

b) Ribossomos, RNAm, RNAt, polipeptídios, aminoácidos.

c) Ribossomos, RNAm, RNAt, polissacarídeos, aminoácidos.

d) Ribossomos, RNAt, RNAm, polipeptídios, monossacarídeos.

e) Ribossomos, RNAt, RNAm, polipeptídios, aminoácidos.

GABARITO

01

02

03

04

05

06

07

08

09

10

C

E

C

FFVVF

C

VVVFF

B

D

E

A

11

12

13

14

15

16

17

18

19

20

D

D

C

B

E

FFVFV

E

B

B

B

21

22

23

24

25

26

27

28

29

30

D

C

C

VVFVV

E

B

D

A

D

B

 

Anúncios

Deixe um comentário

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair / Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair / Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair / Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair / Alterar )

Conectando a %s

Categorias

%d blogueiros gostam disto: