Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE GENÉTICA MOLECULAR (5)

01. (UNESP) Na segunda metade do século XIX, Mendel havia descoberto algumas regras básicas sobre herança, mas suas ideias passaram despercebidas. No início dos anos 1900, Walter Sutton e outros verificaram que o comportamento dos cromossomos na divisão celular correspondia ao descrito por Mendel para os fatores hereditários. O que faltava era comprovar a ligação entre esses dados. A descoberta que possibilitou isso foi:

a) As mutações genéticas estão correlacionadas às mudanças evolutivas, por Theodosius Dobzhansky.

b) É possível conhecer a exata localização de um gene no cromossomo, como demonstrado por Calvin Bridges.

c) Os raios X aumentam dramaticamente a taxa de mutações, por Hermann Müller.

d) O DNA tem uma conformação em dupla hélice, por James Watson e Francis Crick.

e) Os genes localizam-se em posições específicas do cromossomo, por Thomas Morgan.

02. (X Olimpíada Brasileira de BIOLOGIA)

O texto abaixo descreve bioquimicamente as diferenças observadas por Mendel quanto à forma da semente. Analise o texto e responda esta questão

• O alelo A que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases que codifica a enzima SBE-1 (starch-branching enzyme ou enzima ramificadora do amido).

• O alelo a que codifica a semente rugosa, é um fragmento de DNA com uma inserção de 800 pares de bases, portanto o gene possui 4,1 mil pares de bases e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, levando a um maior acumulo de água, e quando a semente seca torna-se rugosa.

Supondo que os fragmentos de DNA descritos correspondem a éxons (segmentos ativos) espera-se que as enzimas codificadas pelos genes A e a, contenham, respectivamente, o seguinte número aproximado de aminoácidos:

a) 1.100; 267.

b) 1.100; 4.100.

c) 2.200; 2734.

d) 9.900; 12.300.

e) 1100; 1367.

03. Os seres vivos são farinha do mesmo saco.

Analise as alternativas a seguir e assinale a que melhor justifica a seguinte frase:

a) Todos os seres vivos têm uma composição química semelhante: são feitos da mesma matéria.

b) Há no corpo centenas de trilhões de células controladas pelos DNAs.

c) No DNA está escrito até o jeito dos filhos que você pode vir a ter.

d) A duplicação do DNA significa a duplicação dos cromossomos, conduzindo à duplicação das células.

04. “Radioatividade após acidente de Fukushima causou mutação nas borboletas”

“Mutações genéticas foram detectadas em três gerações de borboletas nos arredores da central nuclear japonesa de Fukushima, informaram cientistas japoneses, o que aumenta os temores de que a radioatividade possa afetar outras espécies.”

                                                                                                                                                                                 Fonte: UOL Notícias Tecnologia.

O texto acima é um fragmento de uma notícia veiculada em agosto deste ano na mídia eletrônica. De acordo com os dados da notícia e seus conhecimentos sobre o assunto, assinale a alternativa correta:

a) Os cientistas japoneses concluíram que se até as borboletas, que são seres pequenos e frágeis, foram afetadas pela radioatividade, com certeza os seres humanos também foram.

b) Em Fukushima, a radioatividade atuou como agente mutagênico para as borboletas dos arredores da central nuclear, causando nelas alterações genéticas.

c) A radioatividade causou mutação nas borboletas da região próxima a Fukushima, pois as borboletas são seres que têm predisposição genética para esse tipo de erro.

d) A mutação, como a ocorrida nas borboletas, nada mais é do que uma diminuição do número de células do organismo.

e) O agente mutagênico, que nesse caso é a radioatividade, é uma substância capaz de multiplicar células normais nos organismos.

05. Sobre os ácidos nucleicos, são feitas as seguintes afirmações:

I. São macromoléculas de elevada massa molecular, que possuem ácido fosfórico, açúcares e bases púricas e pirimídicas em sua composição.

II. Ocorrem em todas as células vivas e são responsáveis pelo armazenamento e transmissão da informação genética e por sua tradução, que é expressa pela síntese proteica.

III. Encontram-se presentes no núcleo dos procariotos e dispersos no hialoplasma dos eucariotos.

IV. Encontram-se normalmente organizados sob a forma de fita simples ou dupla.

Das quatro afirmações anteriores, são verdadeiras:

a) Apenas a III e IV.

b) Apenas a III.

c) Apenas a I, II e IV.

d) Apenas a I e II.

e) Todas as afirmações são corretas.

06. (UNIOESTE) Com relação ao material genético, é correto afirmar que:

01. Cada RNA mensageiro possui, em determinada região de sua molécula, o anticódon.

02. O DNA apresenta, entre suas bases púricas, uracil e o RNA, timina.

04. Entre os cromossomos homólogos ocorre permuta gênica, o que garante a variabilidade genética.

08. As cadeias de RNA mensageiro são produtos da atividade ribossômica.

16. A alteração na seqüência de bases nitrogenadas de um segmento de DNA é uma mutação.

32. O DNA e o RNA, quanto à sua estrutura química, são polipeptídeos.

Soma das alternativas corretas:

07. O esquema abaixo representa um segmento de uma cadeia proteica e os anticódons correspondentes aos aminoácidos.

07

Os códons correspondentes ao cístron são:

a) ACC – CAT – TGA – ATA – GTG.

b) UGG – GUA – ACU – UAU – CAC.

c) TGG – CAT – GTG – ATT – UAU.

d) UGG – CAU – GUG – AUA – CAU.

e) TAT – GTA – ACT – TAT – CAC.

08. Com relação ao DNA, assinale a afirmativa incorreta.

a) As informações hereditárias são codificadas no DNA.

b) Graças à capacidade do DNA de autoduplicar-se, os gens podem manter suas características de uma geração a outra.

c) A molécula de DNA apresenta-se estruturalmente como uma dupla hélice.

d) O DNA é encontrado em grande quantidade no citoplasma e em pequenas quantidades no núcleo.

e) É um polinucleotídeo, sendo cada nucleotídeo formado de desoxirribose, fosfato e base nitrogenada, os quais se unem por meio do fosfato de um nucleotídeo com a pentose do outro.

09. (VUNESP) Um dos filamentos da dupla hélice de uma molécula de DNA tem a seguinte sequência: AACGATCGCTCA. Os seus produtos de duplicação e transcrição são, respectivamente:

a) AACGATCGCTCA; TTGCTAGCGAGT.

b) TTGCTAGCGAGT; UUGCUAGCGAGU.

c) UUCGUACGCACU; TTGCTAGCGAGT.

d) TTGCTAGCGAGT; AACGATCGCTCA.

e) TTCGTACGCACT; AACGATCGCTCA.

10. Com relação ao código genético assinale as afirmações corretas:

01. O código genético é universal, isto é, é o mesmo para todos os seres vivos.

02. Cada trinca de bases do DNA codifica sempre o mesmo aminoácido da cadeia polipeptídica.

04. Cada aminoácido pode ser codificado por mais de uma trinca de bases na cadeia do DNA.

08. O mesmo ribossomo, traduzindo diferentes moléculas de RNAm, dará origem a diferentes tipos de moléculas proteicas.

16. A mesma molécula de RNAm, sendo traduzida por diferentes ribossomos, dará origem a várias moléculas da mesma proteína.

Soma das alternativas corretas:

11. (IFMT) Genes saltadores no DNA humano

O genoma humano é constituído por cerca de 50% de elementos transponíveis DNA, os chamados “genes saltadores”. Alguns desses elementos saltadores saem de um local para se inserir em outro. Outros estão sendo copiados para novos locais, resultando em crescente número de inserções em todo o genoma humano. Seja qual for o mecanismo, todos os elementos transponíveis têm o potencial de afetar a mudança por meio de mutações, duplicações ou supressões. Baseando-se em seus conhecimentos da genética, marque a alternativa que melhor define o termo Genoma.

                                                                                                  (dnaeoutrascoisas.blogspot.com/).

a) Estrutura microscópica constituída pela molécula de DNA.

b) Alelo que só determina o caráter quando ocorre em dose dupla.

c) Aspecto do indivíduo determinado pela expressão das características genéticas.

d) Conjunto dos genes existentes em todos os cromossomas de uma espécie.

e) Segmento do DNA com informações para a síntese de uma proteína.

12. (UEM) Sobre a estrutura e a função dos genes, assinale o que for correto.

01. Os métodos para identificação individual de pessoas pelo DNA, como os testes de paternidade ou de identificação de criminosos e de vítimas, baseiam-se no fato de todos os indivíduos, com exceção dos gêmeos idênticos, apresentarem diferenças nas suas sequências de bases nitrogenadas.

02. Os genes que codificam proteínas exercem sua função com uma de suas fitas servindo de molde para a síntese de RNA mensageiro.

04. Entre todos os tipos de RNA produzidos pela célula, o RNA mensageiro é o único que é sintetizado tendo como molde uma sequência de bases do DNA.

08. Duas moléculas de DNA dupla-hélice com a mesma sequência de bases têm, necessariamente, a mesma proporção de bases.

16. Durante a síntese de proteínas, cada trinca de bases do RNA mensageiro, denominada códon, especifica uma trinca de aminoácidos na tradução.

32. Os arranjos com repetição dos quatro tipos de bases nitrogenadas do RNA mensageiro (Adenina, Guanina, Citosina e Uracila), tomadas três a três, correspondem aos 64 códons de três letras do código genético. Se o RNA mensageiro fosse formado por cinco tipos de bases, seriam possíveis 128 códons de três letras.

64. O mesmo código genético é válido para os genes dos cromossomos dos coelhos e para os genes dos cromossomos da alface.

Soma das alternativas corretas:

13. (IFSul) Em 1962, o premio Nobel de Fisiologia e Medicina foi concedido aos cientistas Francis Crick, Maurice Wilkins (britânicos) e James Watson (norte-americano) por suas pesquisas que determinaram a estrutura molecular do DNA. Sobre o DNA, são feitas as seguintes afirmativas:

I. Possui estrutura em dupla hélice, encontrada no núcleo celular, e sua importância reside no fato de que ele carrega os genes.

II. No emparelhamento das fitas de DNA; se em uma fita tivermos a sequencia de bases AATTTCG, na outra teremos TTAAAGC.

III. É formado por uma pentose denominada desoxirribose e pelas bases nitrogenadas adenina, timina, citosina, guanina e uracila.

IV. Em alguns vírus, são encontrados ácidos nucleicos do tipo DNA espalhados no citoplasma viral.

Estão corretas apenas as afirmativas:

a) I e II.

b) I, II e III.

c) III e IV.

d) I, III e IV.

14. (UERJ) As características abaixo são referentes aos processos de replicação, transcrição e tradução, que ocorrem em seres vivos.

I. A síntese de proteínas tem início antes mesmo do término da transcrição.

II. A grande maioria dos genes contém íntrons, retirados antes da tradução.

III. A síntese de proteínas sempre ocorre em ribossomos livres no citoplasma.

IV. O processo de replicação possui uma única origem.

As características I, II, III e IV estão associadas, respectivamente, aos organismos indicados em:

a) Eucariotos – eucariotos – procariotos – eucariotos.

b) Eucariotos – procariotos – eucariotos – procariotos.

c) Procariotos – eucariotos – procariotos – procariotos.

d) Procariotos – procariotos – eucariotos – procariotos.

15. (IFSuldeMinas) Leia o texto abaixo:

“Carta sobre descoberta de DNA vendida por 4 milhões de euros: em 1953, Francis Crick dirigiu uma carta ao seu filho de 12 anos para comunicar a descoberta da estrutura DNA, já retratada por Wilkins e Franklin por difração de raios-X. A carta foi vendida num leilão, em Nova Iorque, por 4 milhões de euros. Há 60 anos, Crick enviou esta missiva de sete páginas onde explicava o que era o ácido desoxirribonucleico (DNA) e enumerava as quatro bases que o componham, descoberta feita com o seu colega James Watson, ambos ganhadores do Prémio Nobel. Uma frase da carta diz: “cremos ter descoberto o mecanismo básico de cópia pelo qual a vida surge da vida. Como deves imaginar, estamos muito emocionados”.

                        Fonte: http://www.cienciahoje.pt/index.php?oid=57442&op=all. Acesso em 11 de Abril de 2013

A partir dos seus conhecimentos e tendo por base a descoberta abordada no texto apresentado, assinale a alternativa correta.

a) O DNA é composto por quatro bases nitrogenadas, que apresentam proporções iguais entre si.

b) As bases nitrogenadas do DNA são: A (adenina), U (uracila), G (guanina) e C (citosina).

c) Após essa descoberta, foi confirmada a previsão de muitos cientistas, que atribuíam às proteínas a portabilidade dos fatores genéticos.

d) O modelo proposto por Crick e Watson retratava uma estrutura tridimensional do DNA, na qual duas cadeias helicoidais se enrolavam em torno do mesmo eixo.

16. (UNIPAC) Na abertura da novela O Clone, aparece estilizada uma molécula de DNA. Abaixo, esquematizamos a molécula segundo o modelo proposto por James Watson e Francis Crick. Observe:

16

Assinale a alternativa incorreta, referente à molécula:

a) Em células eucariotas, o DNA está combinado com proteínas e organizado em fibras de cromatina no núcleo.

b) O DNA é constituído de milhares de ribonucleotídeos ligados à estrutura (a) através de pontes de hidrogênio.

c) O DNA armazena todas as informações genéticas necessárias para especificar a estrutura de proteínas.

d) Transcrição é a propriedade do DNA de servir de molde para gerar moléculas de RNAs.

e) No desenho acima, (b) e (c) representam, respectivamente, citosina e guanina.

17. (UFT) A figura a seguir representa uma dupla fita de DNA, com as seguintes características definidas: polaridades (5’ e 3’), ponto origem de replicação (Ori), direções de abertura das fitas e de síntese das novas cadeias de DNA (setas). Os fragmentos designados por A, B, C e D são as fitas moldes para o processo replicativo.

17

Com relação à replicação contínua e descontínua, marque a alternativa correta:

a) A replicação será contínua para os fragmentos A e C e descontínua para os fragmentos B e D.

b) A replicação será contínua para os fragmentos A e B e descontínua para os fragmentos C e D.

c) A replicação será contínua para os fragmentos B e D e descontínua para os fragmentos A e C.

d) A replicação será contínua para os fragmentos B e C e descontínua para os fragmentos A e D.

e) A replicação será contínua para os fragmentos A e D e descontínua para os fragmentos B e C.

18. (UECE) A anemia falciforme decorre de uma mutação específica no gene da beta-globina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGC

CCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG

GCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAA

GGAGACCAATAGAAACTGGGCATGT

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGC

CCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG

GCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAA

GGAGACCAATAGAAACTGGGCATGT

Para a tradução desses genes, é (são) necessário(s):

a) Somente o mRNA.

b) A fita complementar do DNA e o mRNA.

c) Somente o mRNA e o rRNA.

d) DNA, mRNA; tRNA e rRNA.

19. (UFV) A sequência dos cinco primeiros aminoácidos (aa), de um peptídeo em início de síntese, está representada abaixo. Na tabela, aparecem também representados alguns RNAs transportadores (tRNA) e seus respectivos aminoácidos.

19a

19b

Assinale a alternativa que contém o mRNA que traduziu a sequência de aminoácidos para formar o peptídeo:

a) 5 -AUG-CUC-CCC-CAA-GCA- 3.

b) 5 -CCC-CAA-GCA-CUC-AUG- 3.

c) 5 -CAA-GCA-GAG-UAC-CCC- 3.

d) 5 -GCA-CUC-GUU-AUG-CAA- 3.

e) 5 -UAC-GAG-GGG-GUU-CGU- 3.

20. (UEMG) Em 1940 os biólogos George Beadle e Eward Tatum anunciaram:

20

Esse anúncio indica que os biólogos descobriram:

a) A estrutura da molécula de DNA.

b) A sequência de bases do DNA.

c) O mecanismo de transcrição do código genético.

d) O papel biológico do Gene.

gab

 

Anúncios

Responses

  1. Qual a resolução da 2?

    • ALTERNATIVA CORRETA: (“1100; 1367.”)
      – A unidade de codificação é formada por três nucleotídeos (ver CÓDIGO GENÉTICO, matéria publicada neste blog no dia 15.11.2010). Dessa forma:
      I. GENE A: 3,3 mil pares de bases (ver enunciado).
      * 3.300/3 = 1.100.
      II. GENE B: 4,1 mil pares de bases (ver enunciado).
      * 4.100/3 = 1.36666 (1.367).
      Djalma Santos


Deixe um comentário

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair / Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair / Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair / Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair / Alterar )

Conectando a %s

Categorias

%d blogueiros gostam disto: