Publicado por: Djalma Santos | 18 de maio de 2017

TESTES DE GENÉTICA MOLECULAR (10)

01. (UNICENTRO) A relação A + G / C + T = 0,2 em uma das fitas do DNA. Sabendo-se que, nessa molécula, há duas fitas, o valor dessa mesma relação, A + G / C + T, na fita complementar, é de:

a) 0,2.

b) 0,8.

c) 1,0.

d) 5,0.

02. (UEPG) James Watson e Francis Crick resolveram a estrutura do DNA em 1953, rendendo-lhes inclusive um prêmio Nobel. Em relação às características desta molécula, assinale o que for correto.

01. Uma mutação em uma única base nitrogenada não é capaz de prejudicar a estrutura de uma proteína e levar a manifestação de uma doença. Já as mutações cromossômicas, por exemplo, trissomia do 21, são extremamente graves.

02. A replicação do DNA é dita semiconservativa, sendo que cada uma das fitas é utilizada como molde para a síntese de uma fita complementar, polimerizada pela enzima DNA polimerase.

04. O DNA é uma molécula constituída por nucleotídeos organizados em fita única, os quais se unem por ligações denominadas pontes de hidrogênio.

08. O DNA é constituído por vários nucleotídeos em sequência, os quais são formados por um grupo fosfato, uma base nitrogenada e uma pentose, a desoxirribose.

16. Uma sequência de DNA, denominada gene, pode ser transcrita em moléculas de RNA pela enzima RNA polimerase, processo denominado de transcrição.

Soma das alternativas corretas:

03. (Unisinos) Os ácidos nucleicos (o DNA, ácido desoxirri­bonucleico, e o RNA, ácido ribonucleico) são macromoléculas formadas por unidades mo­noméricas menores (nucleotídeos). Ocorrem em todas as células vivas e realizam o arma­zenamento, a transmissão e a tradução da in­formação genética. Com base nisso, avalie as proposições abaixo, comparando a estrutura desses ácidos.

I. O RNA é formado por duas cadeias polinucleotídi­cas e está envolvido no processo de transcrição e síntese de proteínas.

II. A quantidade de RNA varia de célula para célula, e sua presença pode ocorrer por curtos períodos de tempo.

III. O DNA armazena a informação genética da maioria dos “seres vivos” e é quimicamente pouco estável.

Sobre as proposições acima, é correto afirmar que:

a) apenas I está correta.

b) apenas II está correta.

c) apenas III está correta.

d) apenas I e II estão corretas.

e) I, II e III estão corretas.

04. (UDESC) Analise as proposições, em relação aos Ácidos Nucleicos, e assinale (V) para verdadeira e (F) para falsa.

( ) Os ácidos nucleicos são moléculas gigantes formadas por unidades chamadas de nucleotídeos.

( ) O RNA transportador é formado a partir de regiões específicas do DNA.

( ) O RNA ribossômico associado com proteínas forma os ribossomos.

( ) O DNA apresenta-se altamente condensado nas células procarióticas.

Assinale a alternativa que apresenta a sequência correta, de cima para baixo.

a) F – V – V – F.

b) F – F – V – V.

c) V – V – V – F.

d) V – F – V – V.

e) V – F – F – V.

05. (UCS) A Reação em Cadeia da Polimerase (Polymerase Chain Reaction – PCR) é uma técnica muito utilizada em pesquisas científicas, que consiste na amplificação (ou a criação de várias cópias) de um segmento do DNA. É uma técnica utilizada para o sequenciamento de genes, diagnóstico de doenças, testes de paternidade e até para a criação de organismos geneticamente modificados. Essa técnica só é possível devido às características naturais de replicação da fita de DNA. Em relação à replicação do DNA, pode-se afirmar que:

a) é um processo chamado de semiconservativo, pois uma das fitas é nova (recém-sintetizada), e a outra provém da dupla fita de DNA já existente, ambas formando uma dupla fita.

b) a separação das fitas, no momento da duplicação, se dá pelo efeito de uma enzima chamada DNA Polimerase.

c) o RNA formado a partir do processo de replicação do DNA é chamado de RNA mensageiro.

d) os ribossomos se ligam à fita de DNA durante o processo de replicação e, a partir dessa ligação, são sintetizadas novas proteínas.

e) os pares da fita original de DNA se separam, e os nucleotídeos livres vão se emparelhando com a fita nova, sempre seguindo a regra A-U C-G.

06. (PUC-PR) Leia o texto a seguir:

Genes bailarinos

Equipe do Incor reduz de 2 mil para 80 os fragmentos de DNA candidatos a explicar a origem da hipertensão

Recebemos como carga genética os mecanismos controladores da pressão, eles fazem a síntese dos mecanismos pressores e depressores. Essa carga pode facilitar a produção de substâncias pressoras ou formar menos substâncias hipotensoras. Essa predisposição, entretanto, não basta. Para o problema eclodir, há que se ter o concurso decisivo do meio ambiente, que está o tempo todo suscitando regulação da pressão arterial. E esse meio ambiente é o sal, a inatividade, a obesidade, o estresse, todas essas coisas que, de uma forma ou de outra, mexem com o sistema de regulação. Alguém com um sistema de regulação muito bom pode ser submetido a todas as pressões ambientais e seguir com a pressão normal. Mas outro, com um sistema muito ruim, pode ficar sem comer um grama de sal, deitado numa rede, e vai ficar hipertenso. É esse “o estado da arte atual” sobre a hipertensão essencial ou primária. Sabe-se dessa “combinação do terreno com o meio ambiente” e não se sabe “mexer no terreno” preventivamente, mas é o que se quer conseguir. Se os genes envolvidos na hipertensão forem identificados, se for possível saber a carga genética de cada um e, com base nisso, trabalhar com aconselhamento genético, talvez a hipertensão essencial que atinge 50% dos adultos acima de 60 anos se torne uma epidemia do passado.

Disponível em: <http://revistapesquisa.fapesp.br/2012/08/22/genes-bailarinos/?cat=medicina&gt;. Adaptado.

A identificação dos fragmentos de DNA possibilitará uma proposta de intervenção, uma vez que,

a) o conhecimento da carga genética, que associada aos fatores do meio é o que define o fenótipo do indivíduo, possibilita a compreensão da manifestação da hipertensão.

b) sabendo-se quais são os genes envolvidos, é possível uma terapia genética que induza a não manifestação desse material, a qual estaria disponível para a maior parte da população.

c) conhecendo-se o genótipo dos hipertensos, descobre-se a única fonte desencadeadora do aumento de pressão arterial.

d) os fatores ambientais são preponderantes sobre os fatores genéticos, os quais só se manifestam quando induzidos pelo meio.

e) a hipertensão não tem relação com hábitos de vida, mas está associada unicamente à predisposição genética.

07. (ACAFE)

Mutação genética explica preferência por alimentos gordurosos

A predileção por comidas gordurosas em algumas pessoas com sobrepeso ou obesas pode ter uma explicação genética. Um estudo conduzido na Universidade de Cambridge, no Reino Unido, e divulgado na última edição da revista Nature Communications, mostra que uma mutação no gene MC4R faz com que indivíduos tenham um paladar reduzido para o açúcar levando-os, como mecanismo de compensação, a ingerir doses exageradas de gordura. A estimativa é de que essa falha genética acometa uma em cada 100 pessoas com problemas de peso.

Fonte: Correio Braziliense, 10/10/2016.Disponível em: http://www.correiobraziliense.com.br

Assim, analise as afirmações a seguir.

I. As mutações são denominadas sem sentido quando alteram o código genético, mas não alteram o produto gênico.

II. As mutações podem ser causadas por erros durante o processo de replicação do DNA, por agentes físicos, por agentes químicos, e por agentes biológicos, como alguns vírus, por exemplo.

lll. Deleções são mutações nas quais um trecho de DNA é perdido. As deleções tendem a ser, especialmente, mais prejudiciais quando o número de pares de bases perdidas não for um múltiplo de três.

lV. As aneuploidias são mutações em que há perda ou acréscimo de 1 ou mais cromossomos da célula. Surgem devido a erros na distribuição dos cromossomos durante as divisões celulares, tanto na mitose quanto na meiose.

Todas as afirmações estão corretas em:

a) I – II – III.

b) II – III – IV.

c) II – IV.

d) III – IV.

08. (UFU) A Klebsiella pneumoniae carbapenemase (KPC), também conhecida como superbactéria, quando entra no organismo, é capaz de produzir infecções graves. O surto da bactéria está frequentemente relacionado ao uso indiscriminado de antibióticos. A seguir está representado como surgem cepas resistentes.

08

Considerando os argumentos neodarwinistas para explicar a multirresistência da KPC aos antibióticos, é incorreto afirmar que:

a) Bactérias resistentes podem transferir a outras bactérias anéis de DNA que garantem a variabilidade entre bactérias, conferindo resistência aos antibióticos.

b) A utilização de antibióticos de forma indiscriminada propicia a seleção de bactérias resistentes.

c) O uso de antibióticos provoca alterações no DNA da bactéria, tornando-a cada vez mais resistente.

d) O mecanismo de mutação no código genético das bactérias pode conferir resistência a antibióticos.

09. (UNESP) Nas células ocorrem reações químicas para a síntese de moléculas orgânicas necessárias à própria célula e ao organismo. A figura mostra a reação química de formação de uma estrutura molecular maior a partir da união de três outras moléculas menores.

09

Esta reação química ocorre no interior da célula durante a:

a) formação dos nucleotídeos.

b) tradução do RNA mensageiro.

c) formação dos triglicerídeos.

d) transcrição do DNA.

e) síntese dos polissacarídeos.

10. (UNICAMP) A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses.

CACTTGTAAAACCAGTATAGACCCTAG (1)

CACTTGTAAAACCAGGATAGACGCTAG (2)

CACTTGTAAAACCAGTATAGACGCTAG (3)

CATTTTTAACACCAGGATAGACGCTAT (4)

Assinale a alternativa correta.

a) As espécies 1 e 4 são mais próximas entre si do que as espécies 1 e 3.

b) As espécies 2 e 3 são mais próximas entre si do que as espécies 1 e 3.

c) As espécies 1 e 3 são mais próximas entre si do que as espécies 3 e 4.

d) As espécies 2 e 4 são mais próximas entre si do que as espécies 1 e 2.

11. (Unitau) “[…] o refugiado austríaco Erwin Chargaff, do College of Physicians and Surgeons da Universidade Columbia, empregou uma nova técnica – cromatografia em papel – para medir as quantidades relativas das quatro bases em amostras de DNA extraídas de uma variedade de vertebrados e bactérias. Embora algumas espécies tivessem um DNA em que predominavam a adenina e a timina, outras tinham DNA com mais guanina e citosina. Despontou assim a possibilidade de não haver duas moléculas de DNA com a mesma composição.”

WATSON, J. D. DNA: O Segredo da Vida. São Paulo: Companhia das Letras, 2005, p. 470.

A descrição de Watson indica o momento inicial para a elaboração da Regra de Chargaff. Com base nessa regra, se analisarmos um fragmento de DNA com 320pb, das quais 30% são compostas por nucleotídeos contendo timinas, qual a quantidade de bases citosina e de guanina nesse mesmo fragmento?

a) Citosina = 70; guanina = 70.

b) Citosina = 64; guanina = 64.

c) Citosina = 128; guanina = 128.

d) Citosina = 70; guanina = 30.

e) Citosina = 128; guanina = 64.

12. (UEM) Sobre o material genético, assinale o que for correto.

01. A duplicação do material genético de eucariotos ocorre durante a anáfase da mitose.

02. Entende-se por gene o segmento de DNA capaz de codificar um RNA.

04. Em um gene ativo, a RNA polimerase está complementando os desoxirribonucleotídeos da região codificante com ribonucleotídeos complementares e realizando ligações fosfodiester entre eles.

08. Toda mutação em genes que codificam proteínas em eucariotos altera a sequência de aminoácidos na proteína codificada neste gene.

16. Eucariotos se distinguem de procariotos, neste quesito, por possuírem histonas associadas ao DNA, formando cromatina.

Soma das alternativas corretas:

13. (Anhembi Morumbi) Uma determinada sequência de nucleotídeos de um segmento de RNA mensageiro, ao ser traduzida pelos ribossomos, codifica uma sequência específica de aminoácidos. Essa correspondência fundamenta o sistema genético de codificação que:

a) regula a síntese de aminoácidos a partir dos nucleotídeos do RNA transportador.

b) varia entre as diferentes espécies, em função da alta diversidade existente.

c) constitui a relação em que cada nucleotídeo de adenina se liga a um nucleotídeo de timina.

d) é baseado em apenas 20 possibilidades de trincas de nucleotídeos, denominadas códons.

e) determina a exata posição dos aminoácidos na proteína sintetizada.

14. (PUC-RIO) A interação do DNA com as proteínas histonas é responsável pelo enovelamento e compactação do DNA nos núcleos das células eucarióticas, funcionando também como uma forma de regular a expressão gênica. Dois tipos celulares (por exemplo, linfócitos e neurônios) oriundos de um mesmo organismo não são iguais porque diferem:

a) nos ribossomos.

b) nos cromossomos.

c) nas proteínas histonas.

d) nas sequências das moléculas de DNA.

e) nas moléculas de RNA mensageiro produzidas.

15. (FATEC) Leia o texto para responder esta questão.

Hormônio do crescimento de plantas é alvo de pesquisa chinesa

Um grupo de pesquisadores tem como principal objetivo desvendar o funcionamento dos hormônios nas plantas.

“Um desses fitormônios é o etileno, molécula de gás que regula uma ampla gama de processos, incluindo o amadurecimento de frutos, o envelhecimento de folhas e de flores, a tolerância ao estresse e a defesa contra patógenos”, explicou o pesquisador Hongwei Guo, professor da Escola de Ciências da Vida da Universidade de Pequim.

“Temos estudado fatores que medeiam a regulação de respostas de plantas ao etileno, como a interação com outros fitormônios. Essas interações indicam a existência de complexas redes de sinalização na ação do etileno nas plantas”. Entre esses outros hormônios, o pesquisador mencionou a citocinina, a auxina e a giberelina.

“Identificamos que os fatores de transcrição conhecidos como EIN3 e EIL1 representam uma integração fundamental nas achoes entre o etileno e outros fitormônios”, disse Guo.

<http://tinyurl.com/jrz82hw&gt; Acesso em: 24.08.2016. Adaptado.

Fatores de transcrição como o EIN3 e EIL1 são proteínas essenciais no controle da expressão genetica. Quando elas se ligam ao DNA de células eucarióticas, permitem que haja uma ligação entre a enzima RNA-polimerase e o DNA, possibilitando, assim, a transcrição e a futura tradução.

Caso a equipe de pesquisadores consiga suprimir fatores de transcrição como o EIN3 e o EIL1 em algumas celulas, elas deverão apresentar, quando comparadas as demais células,

a) maior concentração de DNA.

b) maior concentração de clorofilas.

c) maior concentração de cloroplastos.

d) menor concentração de celulose.

e) menor concentração de RNA.

16. (UFPA) Griffith, em 1928, em experimentos realizados com linhagens da bactéria Streptococus pneumoniae, conforme ilustra a figura abaixo, demonstrou que:

I. uma linhagem (S) é letal quando inoculada em camundongos (a), enquanto que outra linhagem (R) é um tipo mutante não letal (b).

II. bactérias (S) são encapsuladas com polissacarídeos, que não estão presentes nas bactérias (R).

III.  bactérias (S), quando mortas pelo calor não provocavam morte nos camundongos (c). No entanto, uma mistura de bactérias (S) mortas pelo calor e bactérias (R) vivas provocava a morte dos camundongos (d).

Além disso, as células vivas recuperadas dos camundongos mortos geravam colônias (S) que eram letais em injeção subsequente.

16

Com base nos conhecimentos atuais sobre biologia molecular, a alternativa correta para a descrição do processo de transformação representado acima é:

a) O envoltório celular pode ser o agente transformante, visto que bactérias R mortas pelo calor e bactérias S apresentam constituição semelhante de seus envoltórios celulares.

b) Um experimento no qual se destrói o DNA das bactérias resultaria em bactérias R incapazes de transformar bactérias S em virulentas, o que demonstra que o DNA é o agente responsável pela modificação da expressão gênica nas bactérias S.

c) A diferença entre as linhagens S e R é a presença, nestas últimas, de uma capa de polissacarídeos (açúcares) em seu revestimento. Logo, a destruição de polissacarídeos deve resultar em perda da capacidade transformante das bactérias R mortas pelo calor.

d) A desnaturação proteica das bactérias R mortas pelo calor comprova que o agente transformante são as proteínas.

e) Nenhum procedimento isolado de destruição química das principais categorias de macromoléculas resultaria em perda do poder transformante das bactérias S, uma vez que a transformação resulta da ação combinada de todas as macromoléculas presentes na célula.

17. (UFAM) As moléculas de DNA e RNA são fantásticos repositórios informacionais comuns a todos os seres vivos. Analise as afirmativas e assinale a alternativa correta:

a) Houve um período abiótico em que as moléculas de DNA dominaram o planeta.

b) Além de serem moléculas informacionais, o DNA e o RNA também apresentam atividade enzimática.

c) Na dupla hélice do DNA, as bases púricas (citosina e timina) ligam-se às bases pirimídicas (adenina e guanina).

d) Um nucleotídeo nos ácidos nucleicos é formado por um fosfato ligado a um açúcar que, por sua vez, é ligado a uma base nitrogenada.

e) As moléculas de RNA são compactadas nos nucleossomas.

18. (UERR) Analise as afirmativas sobre os ácidos nucléicos DNA e RNA.

I. O DNA e o RNA são formados pelo encadeamento de grande número de moléculas menores, os nucleotídeos.

II. No RNA, está presente a pentose ribose e, no DNA, a pentose desoxirribose.

III. As duas cadeias de um RNA mantêm-se unidas por meio de ligações de hidrogênio

IV. Adenina, citosina, timina e guanina ocorrem tanto no DNA quanto no RNA.

V. A transcrição é o processo pelo qual a molécula de RNA é formada a partir da molécula de DNA.

Estão corretas apenas as afirmativas:

a) I, II e V.

b) II, III e IV.

c) I, II e III.

d) III, IV e V.

e) I, III e V.

19. (UEA) Dois irmãos gêmeos univitelinos de pele clara moravam em Gramado (RS). Um dos irmãos se mudou para Fortaleza (CE), onde começou a praticar surfe, exposto frequentemente ao Sol. O irmão que permaneceu em Gramado dificilmente ficava exposto ao Sol e somente praticava esportes em ambientes fechados. Passado um ano, os irmãos se reencontraram e a diferença entre o tom de pele de ambos ficou evidente. Com relação à síntese de melanina, essa diferença deve-se ao fato de os irmãos apresentarem:

a) genótipos iguais que levam à síntese de diferentes quantidades de melanina, dependendo da interação desses genótipos com o ambiente.

b) genótipos diferentes que levam à síntese de diferentes quantidades de melanina, dependendo da interação desses genótipos com o ambiente.

c) genótipos diferentes que levam à síntese da mesma quantidade de melanina, independentemente das condições do ambiente.

d) genótipos iguais que levam à síntese da mesma quantidade de melanina, independentemente das condições do ambiente.

e) genótipos iguais que sofrem mutações que levam à síntese da mesma quantidade de melanina, para adaptar a pele ao tipo de ambiente.

20. (URCA) O DNA é chamado molécula da vida. O princípio da ação dessa molécula é levar as características de uma geração para outra. A respeito do DNA é correto:

a) as pontes de hidrogênio são responsáveis pelo código genético.

b) as bases nitrogenadas são os açúcares presentes nos ácidos nucléicos.

c) as variações ocorrentes nas espécies são variações do ácido fosfórico.

d) a diferença entre DNA e RNA está apenas no tamanho entre essas moléculas.

e) a base do código genético são as variações dos tipos de bases nitrogenadas.

gab

 

Anúncios

Deixe um comentário

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair / Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair / Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair / Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair / Alterar )

Conectando a %s

Categorias

%d blogueiros gostam disto: