Publicado por: Djalma Santos | 15 de novembro de 2015

TESTES DE CITOLOGIA (4)

01. (UFRN) A bactéria Shigella dysenterie e o protozoário Entamoeba histolítica infectam o homem, causando disenteria. Embora sejam organismos unicelulares, diferem entre si na sua organização, no entanto, apresentam estruturas celulares que são comuns. As estruturas celulares que são encontradas tanto nas bactérias como nos protozoários são:

a) Nucléolo, membrana plasmática e cromossomo.

b) Carioteca, mitocôndria e ribossomo.

c) Nucleoide, plasmídeo e retículo endoplasmático.

d) Cromossomo, membrana plasmática e ribossomo.

02. (UEM) Considere a representação esquemática das células abaixo e identifique o que for correto.

02

01. Na organela apontada pela seta 1, ocorre a glicólise e o ciclo de Krebs

02. As organelas 1 e 2 contêm DNA, RNA e ribossomos e são capazes de se autoduplicarem.

04. Na organela apontada pela seta 4, as proteínas são modificadas, separadas e empacotadas em bolsas membranosas para serem enviadas aos locais em que atuarão.

08. A cromatina localiza-se exclusivamente na organela apontada pela seta 3.

16. A representação à esquerda refere-se a uma célula eucariótica vegetal e a da direita a uma célula eucariótica animal.

Soma das alternativas corretas:

03. Processos que podem ocorrer em bactérias produzindo alterações genéticas são:

a) Mutação gênica e meiose.

b) Mutação gênica e conjugação.

c) Mutação gênica e clonagem.

d) Meiose e conjugação.

e) Meiose e clonagem.

04. (UFPel) As células são formadas por compostos orgânicos e inorgânicos e a maior parte da massa dos seres vivos é formada por I, que é uma substância inorgânica. Tanto os seres procariotos quanto os eucariotos apresentam a/o II, que possui em sua constituição moléculas de ácido fosfórico, pentoses e bases nitrogenadas. Todas as células possuem membrana plasmática, que apresentam como componente estrutural a/o III, sendo o colesterol um exemplo clássico desse componente. A molécula de IV também está presente na membrana plasmática; ela é formada por vários aminoácidos e pode ser utilizada como fonte de energia. Porém, a/os V são as principais fontes de energia da célula e estão presentes também na estrutura dos ácidos nucleicos (DNA e RNA). Os números I, II, III, IV e V correspondem respectivamente às seguintes moléculas:

a) Água, carboidrato, proteína, ácido nucleico e lipídios.

b) Água, ácido nucleico, lipídio, proteína e carboidratos.

c) Proteína, lipídio, água, ácido nucleico e carboidratos.

d) Água, proteína, lipídio, ácido nucleico e carboidratos.

e) Lipídio, água, ácido nucleico, carboidrato e proteínas.

05. (OBJETIVO-SP) Uma das evidências que apoiam a teoria endossimbiótica é a existência de organismos como Pelomyxa palustris. Esta ameba, de grandes dimensões, possui vários núcleos individualizados. No seu citoplasma, não existe retículo endoplasmático nem sistema golgiense, mitocôndrias ou centríolos. Ela vive em ambientes aeróbios, em fundos lodosos, alimentando-se de algas e bactérias. No seu interior, é possível encontrar três tipos de bactérias endossimbióticas que apresentam um metabolismo análogo ao das mitocôndrias e beneficiam a ameba. De acordo com as informações do texto, foram feitas algumas afirmações sobre a ameba mencionada.

I. Trata-se de um ser vivo que não consegue sintetizar proteínas nem realizar uma divisão celular.

II. Não é possível encontrar moléculas de ATP no citosol desse ser.

III. As bactérias encontradas no interior dessa ameba atuam como parasitas.

IV. Se essa ameba for cultivada em um meio de cultura que contenha antibióticos capazes de atravessar a membrana plasmática, ela poderá morrer depois de um tempo.

Está correto apenas o contido em:

a) IV.

b) I e II.

c) I e III.

d) III e IV.

e) II, III e IV

06. (UEAP) Se fôssemos comparar a organização e o funcionamento de uma célula eucarionte com o que ocorre em uma cidade, poderíamos estabelecer determinadas analogias. Correlacione os locais da cidade com as principais funções correspondentes às organelas celulares e assinale a alternativa correta.06

a) I-4, II-3, III-2, IV-5, V-1, VI-6, VII-7.

b) I-3, II-4, III-5, IV-1, V-2, VI-6, VII-7.

c) I-1, II-2, III-3, IV-4, V-5, VI-6, VII-7.

d) I-5, II-4, III-1, IV-3, V-2, VI-6, VII-7.

e) I-3, II-4, III-1, IV-5, V-2, VI-7, VII-6.

07. (UFPA) Os processos celulares estão interligados de tal forma que cada organela, cada componente do citoquesqueleto e o citosol encontram-se direta ou indiretamente vinculados a eventos fisiológicos celulares. Uma forma de correlação fisiológica direta, entre membrana, citoplasma e núcleo, está indicada na alternativa:

a) A duplicação dos centríolos direciona a mobilização dos microtúbulos e consequente redistribuição de organelas para futuras células filhas.

b) Fagocitose de bactérias resulta na formação de um fagolisossomo, o qual transporta, durante a digestão, moléculas básicas ao citosol que podem ser direcionadas às atividades das demais organelas, como lipídios, aminoácidos, monossacarídeos e nucleotídeos.

c) A exocitose pode ser observada tanto na liberação de enzimas de digestão extracelular, como na liberação de neurotransmissores dentro de uma fenda sináptica. Ambos os processos necessitam de sinais extracelulares para ocorrer.

d) O bloqueio da difusão de O2 para dentro da célula afeta a respiração celular, o que leva ao declínio comprometedor das atividades mitocondriais e induz morte celular programada.

e) Receptores de superfície induzem reações enzimáticas em cascata que resultam na fosforilação de proteínas de membrana nuclear e desintegração desta, o que marca o início do processo de divisão celular.

08. (UFJF) “A presença de cianotoxinas em mananciais de abastecimento público tem se tornado um problema crescente no Brasil e existe uma preocupação, tanto dos governantes quanto da opinião pública, de que essas toxinas possam afetar a saúde humana, seja através do consumo de água contaminada, seja através do consumo de pescado. A ocorrência de casos de contaminação de humanos por água de abastecimento público já é um fato no Brasil, como a tragédia ocorrida em Caruaru (PE) em 1996 e um episódio de intoxicação de pacientes de hemodiálise no Rio de Janeiro em 2001”.

FERRÃO-FILHO. A.S. et al. Florações de cianobactérias tóxicas no Reservatório do Funil: dinâmica sazonal e consequências para zooplâncton. Oecologia brasiliensis, Rio de Janeiro, v. 13, n. 2, p. 346-365, fev. 2009.

As cianotoxinas são substâncias tóxicas produzidas por cianobactérias. Sobre cianobactérias, é correto afirmar que:

a) São sempre organismos marinhos.

b) Não fixam nitrogênio, pois não habitam os solos.

c) São autótrofas fotossintetizantes, com clorofila a como pigmento principal.

d) Estão incluídas no Reino Plantae, uma vez que cianobactérias ancestrais deram origem aos vegetais terrestres.

e) São organismos eucariontes autótrofos.

09. (UFU) Após analisar dois tipos celulares (A e B) ao microscópio eletrônico de transmissão, para verificar detalhes de sua ultraestrutura, um grupo de alunos levantou as seguintes hipóteses:

I. A representa uma célula muscular porque seu citoplasma possui grande quantidade de filamentos de actina e miosina.

II. A apresenta uma alta atividade metabólica, pois foi possível observar um grande número de mitocôndrias entre os feixes de actina e miosina.

III. B representa uma célula produtora de enzimas digestivas porque possui retículo endoplasmático rugoso bem desenvolvido.

IV. B apresenta baixa atividade metabólica, pois foi possível observar o predomínio de cromatina descondensada em seu núcleo.

Assinale a alternativa que apresenta apenas as hipóteses corretas:

a) I e IV.

b) I e III.

c) I, II e III.

d) II, III e IV.

10. (UEM) Assinale o que for correto.

01. Na prófase da mitose, os cromossomos homólogos são observados pareados.

02. Uma célula eucariótica cultivada, durante as fases G1 e S da interface, na presença de timidina radioativa produz duas células-filha com todos os cromossomos radioativos.

04. Células procarióticas não têm mitocôndrias.

08. O nucléolo é uma estrutura relacionada à formação dos ribossomos.

16. Nas células mucosas, a combinação de polipeptídeos e carboidratos para formar glicoproteínas, ou muco, acontece no complexo de Golgi.

32. O centríolo e o cinetossomo são estruturas microtubulares que compõem o sistema membranoso citoplasmático.

64. A timidina radioativa absorvida por uma célula animal será encontrada incorporada aos ácidos nucleicos do núcleo, das mitocôndrias e dos ribossomos.

Soma das alternativas corretas:

11. (UEM) Assinale o que for correto.

01. Uma proteína formada por 40 aminoácidos é codificada por uma molécula de RNA transportador de 40 nucleotídeos.

02. Na mitose ocorre a permuta de material genético, durante o crossing–over, permitindo variabilidade genética entre os seres vivos.

04. A duplicação dos cromossomos ocorre no período de interfase.

08. Na meiose ocorrem duas divisões celulares. A primeira, dita reducional, reduz o número de cromossomos à metade. A segunda, dita equacional, mantém o número de cromossomos nas células resultantes.

16. Segmentação é o nome que se dá ao aumento do número de células, sem aumento do volume total, em consequência da divisão da célula ovo.

32.  Adenina, timina, citosina e guanina são as bases nitrogenadas encontradas nos ácidos ribonucleicos.

Soma das alternativas corretas:

12. (UFPel) Todos os seres vivos são formados por células, alguns são unicelulares e outros multicelulares. As células são de dois tipos: eucariotas ou procariotas, sendo que as primeiras apresentam um rico sistema de endomembranas e as segundas não apresentam organelas membranosas. Para melhor entender “a vida”, é importante que se conheçam as células.

12

Com base nos textos, analise as afirmativas abaixo.

I. O cloroplasto (Figura 2b) está presente apenas nas plantas; portanto, somente estes organismos realizam a fotossíntese.

II. O núcleo (Figura 2a) é uma organela dos eucariotos, sendo formado por uma única membrana que circunda todo o material genético encontrado dentro da célula.

III. O retículo endoplasmático liso, ou agranular, é responsável pela síntese de lipídios e no retículo endoplasmático rugoso, ou granular, ocorre a síntese de proteínas. Uma das diferenças entre as duas organelas é a presença de ribossomos no retículo endoplasmático rugoso.

IV. A figura 1 é o esquema de uma bactéria que apresenta o DNA (Figura 1a) disperso no citoplasma.

V. As organelas presentes nos procariotos são os ribossomos e as mitocôndrias; as demais são encontradas somente nos eucariotos.

Estão corretas apenas as afirmativas:

a) III e IV.

b) I, III e V.

c) III e V.

d) II e IV.

e) I, II e IV.

13. (UEM) A figura abaixo é de uma célula acinosa de pâncreas vista ao microscópio eletrônico. Sobre ela, assinale o que for correto.

13

01. A seta A aponta a secreção sendo absorvida pela célula por processo de fagocitose.

02. A seta B aponta a mitocôndria, que é responsável pelo processo de respiração aeróbica, resultando na liberação de gás carbônico, água e energia.

04. A seta C aponta o aparelho de Golgi, onde ocorre armazenamento e concentração das enzimas.

08. A seta D aponta os grãos de secreção, que são bolsas membranosas repletas de enzimas.

16. A seta E aponta o retículo endoplasmático liso, onde ocorre a formação das enzimas pancreáticas, possuindo as funções de síntese, transporte e armazenamento de enzimas.

32. A seta F aponta o nucléolo, o qual é encontrado em todas as células de eucariontes e procariontes.

64. Além de DNA nuclear, encontra–se DNA, também, na estrutura apontada pela seta B.

Soma das alternativas corretas:

14. (UDESC) A organização dos componentes orgânicos nos seres vivos (com exceção dos vírus), em nível celular, pode ser de dois tipos básicos: procarióticas e eucarióticas. Com relação a estes dois tipos de células, assinale (V) para verdadeiro e (F) para falso.

(  ) Nas células eucarióticas existe uma compartimentalização para atividades específicas como, por exemplo, a digestão e o armazenamento.

(  ) Nas células eucarióticas o material genético encontra-se disperso no citoplasma.

(  ) Nas células procarióticas existem, além da membrana citoplasmática, membranas internas denominadas de endomembranas.

(  ) Em células procarióticas encontram-se além do DNA nuclear o DNA mitocondrial.

(  ) As células procarióticas são encontradas principalmente nas algas e nos fungos.

Assinale a alternativa que indica a sequência correta, de cima para baixo.

a) V – F – F – F – F.

b) F – F – V – F – F.

c) V – V – V – F – V.

d) F – F – V – F – V.

e) V – V – F – F – V.

15. (PUC-RS) Assim como o crescimento corporal, o envelhecimento tem características diferentes nos variados grupos de organis­mos. Um fator que contribui para a incapacidade da manutenção da integridade das células e dos tecidos é o acúmulo de danos causados pelos radicais livres de oxigênio (RLO). No interior da célula, os RLO alteram fosfolipídios e nu­cleotídeos, causando danos, respectivamente, às estruturas de:

a) Carioteca e centríolos.

b) Lâmina celular e cromátides.

c) Parede celular e fuso acromático.

d) Membrana celular e cromossomos.

e) Membrana plasmática e citoesqueleto.

16. (UNITAU) Uma célula que apresenta parede celular, mitocôndrias, carioteca e cloroplastos, mas não possui centríolos, deve ser:

a) Uma bactéria fotossintetizante.

b) Uma célula vegetal.

c) Uma célula animal.

d) Uma levedura.

e) Um euglenoide.

17. (UNICID) O macrófago é um tipo de glóbulo branco humano, que, por meio de pseudópodes, captura células invasoras, as quais serão posteriormente endocitadas e digeridas intracelularmente.

17

Assinale a alternativa que indica, respectivamente, um microrganismo que realiza esse mesmo processo e a estrutura celular responsável pela digestão.

a) Amebas e lisossomos.

b) Cianobactérias e vacúolos.

c) Vírus e cápsulas proteicas.

d) Bactérias e ribossomos.

e) Fungos e retículo liso.

18. (PUC-CAMPINAS) Um aminoácido radioativo foi fornecido a células que o utilizam para fabricar determinado produto de secreção. Após certo tempo, essas células apresentarão sinais de radioatividade principalmente:

a) No núcleo.

b) Nos fagossomos.

c) Nas mitocôndrias.

d) Na membrana plasmática.

e) No complexo golgiense.

19. (UFT) A célula é a menor parte dos seres vivos com forma e função definidas. Por essa razão, afirmamos que a célula é a unidade estrutural destes. A célula, isolada ou junto com outras células, forma todo o ser vivo ou parte dele.

Fonte:<http://www.sobiologia.com.br/conteudos/Corpo/Celula.php&gt; Acesso em:22 de março de 2015.

A estrutura presente nas células responsável pela fronteira do meio intracelular e do meio extracelular, além de participar na regulação da entrada e saída de nutrientes é a(o):

a) Parede celular.

b) Barreira citoplasmática.

c) Mitocôndria.

d) Membrana plasmática.

e) Núcleo.

20. (CESPE-UnB) A diversidade de formas, tamanhos e funções, observada nos mais diferentes tipos celulares de um mesmo organismo, está relacionada aos processos que ocorrem separadamente em cada um desses tipos celulares. Tal diversidade é consequência do padrão de:

a) Replicação do DNA.

b) Sequência de nucleotídeos do DNA.

c) Sequência de nucleotídeos do RNA.

d) Transcrição célula-específico.

gab

Publicado por: Djalma Santos | 20 de outubro de 2015

TESTES DE BOTÂNICA (IX)

01. (UNIOESTE) Referente às estruturas das angiospermas, considere as colunas I e II e assinale a(s) associação(ões) correta(s).

01

01. a1, b2, c3, d4, e5

02. f1, g2, h3, i4, j5.

04. a3, b1, c5, d2, e1.

08. a3, b5, c2, d4, e1.

16. f1, g2, h1, i2, j5.

32. f3, g4, h4, i5, j2.

Soma das alternativas corretas:

02. (FATEC) Grupos de angiospermas das espécies I, II e III foram submetidos a tratamentos fotoperiódicos, manifestando os resultados descritos abaixo.

Quando receberam diariamente 3 horas de luz e 21 de escuro, I não floresceu, mas II e III floresceram. Quando foram expostos a 10 horas diárias de luz e 14 de escuro, I e II floresceram, porém III não floresceu. Com base nesses dados pode-se concluir acertadamente que I, II e III são, respectivamente, plantas:

a) De dia curto, neutras e de dia longo.

b) De dia curto, de dia longo e neutras.

c) Neutras, de dia curto e de dia longo.

d) De dia longo, neutras e de dia curto.

e) De dia longo, de dia curto e neutras.

03. (UNISC) São plantas pertencentes às Gimnospermas e Angiospermas, respectivamente:

a) Palmeira e bananeira; pinheiro e cedro.

b) Cedro e palmeira; bananeira e pinheiro.

c) Ervilha e arroz; cipreste e sequoia.

d) Pinheiros e cipreste; mamona e feijão.

e) Todas as alternativas estão incorretas.

04. (UEPG) A figura abaixo demonstra as etapas da germinação de uma semente de feijão. Associando o papel de cada estrutura numerada na imagem à função durante a germinação da semente, assinale o que for correto.

04

Fonte: Linhares, S.; Gewandsznajder, F. Biologia hoje, os seres

vivos. 15a ed. Volume 2. Editora Ática. São Paulo. 2008.

01. Em 1 é representada a radícula. A radícula dará origem à raiz com pelos absorventes que servem para retirar água e sais minerais do solo.

02. No 3 é representado o hipocótilo. O hipocótilo é a região entre a radícula e o ponto de implantação do(s) cotilédone(s).

04. O número 4 representa a região superior, entre os cotilédones e o meristema apical do caule, a qual recebe a denominação de epicótilo.

08. No 2 é demonstrado o cotovelo. Com a sequência das imagens é possível observar que se trata de uma germinação hipógea, na qual os cotilédones continuam sob o solo.

Soma das alternativas corretas:

05. (UEM) A Botânica baseia-se em diferentes características dos vegetais para facilitar o entendimento sobre eles. Considerando os vegetais a seguir, as regras de nomenclatura botânica e as características morfológicas externas dessas plantas, assinale a(s) alternativa(s) correta(s).

A. Lactuca sativa L. (alface)

B. Coffea arabica L. (café)

C. Phaseolus vulgaris L. (feijão)

D. Zea mays L. (milho)

E. Oryza sativa L. (arroz)

01. Apenas dois gêneros apresentam folhas com nervação reticulada e com sistema radicular axial.

02. Duas espécies têm epíteto específico idêntico e ambas são monocotiledôneas.

04. Três gêneros apresentam dois cotilédones e sistema radicular fasciculado.

08. Três espécies são dicotiledôneas e apresentam folhas com nervação reticulada.

16. São citados quatro espécies e cinco gêneros.

Soma das alternativas corretas:

06. (IFMG) O cladograma abaixo representa as relações filogenéticas dos diferentes grupos vegetais.

06

Disponível em: <http://www.profkenji.com.br/seresvivos/&gt;. Acesso em: 31 out. 2012.

A análise do cladograma permite concluir que:

a) Briófitas são plantas mais simples, pois não apresentam tecidos.

b) Em B a reprodução tornou-se independente da água.

c) Em C o embrião formou-se dentro do óvulo que originou a semente.

d) Pteridófitas são menos evoluídas do que gimnospermas e angiospermas, pois não apresentam vasos condutores de seiva.

07. (ACAFE) A respeito dos diferentes grupos vegetais, analise as afirmações a seguir.

I. Briófitas são avasculares e precisam da água para completar seu ciclo de vida.

II.Pteridófitas apresentam um sistema condutor.

lll. As gimnospermas apresentam sementes protegidas pelo mesocarpo.

lV. As angiospermas são divididas em monocotiledôneas e dicotiledôneas, sendo que monocotiledôneas apresentam feixes liberianos e lenhosos reunidos em grupo no estelo.

Todas as afirmações corretas estão em:

a) I – II – IV.

b) I – II.

c) II – III.

d) III – IV.

08. (FUVEST) As plantas podem reproduzir-se sexuada ou assexuadamente, e cada um desses modos de reprodução tem impacto diferente sobre a variabilidade genética gerada. Analise as seguintes situações:

I. Plantação de feijão para subsistência, em agricultura familiar.

II. Plantação de variedade de cana-de-açúcar adequada à região, em escala industrial.

III. Recuperação de área degradada, com o repovoamento por espécies de plantas nativas.

Com base na adequação de maior ou menor variabilidade genética para cada situação, a escolha da reprodução assexuada é a indicada para:

a) I, apenas.

b) II, apenas.

c) III, apenas.

d) II e III, apenas.

e) I, II e III.

09. (UFSJ) Considere o texto a seguir para responder esta questão

O pinhão é uma semente comestível da Araucária, ou Pinheiro-do-Paraná. Essa árvore é uma gimnosperma. A sazonalidade e a regionalidade de ocorrência da Araucária fazem de suas sementes iguarias, apreciadas normalmente nos meses frios do sul e sudeste do Brasil.

De acordo com o texto, é incorreto afirmar que:

a) Os frutos da Araucária se desenvolvem a partir do pinhão, que são as sementes da planta.

b) As gimnospermas possuem ramos reprodutivos femininos e masculinos distintos, que podem estar num mesmo indivíduo ou em indivíduos separados de acordo com a espécie.

c) O pinhão é a semente da Araucária contendo o embrião da planta. Para que haja o desenvolvimento do pinhão, há necessidade de os grãos de pólen chegar às estruturas femininas adultas e ocorrer a fecundação.

d) Para se reproduzir, a Araucária depende do processo de polinização, que é a transferência (por vento ou por insetos) dos gametas masculinos para as estruturas femininas, onde ocorrerá a fecundação.

10. (UEPG) Com relação às características gerais do reino Plantae, assinale o que for correto.

01. Nos filoides dos musgos, os vasos condutores de seiva transportam água, sais minerais e glicose.

02. Nas briófitas, a principal função dos rizoides é a fixação do musgo e não a absorção de água e sais minerais.

04. Entre as plantas vasculares com semente, as angiospermas apresentam as sementes expostas externamente no órgão reprodutivo.

08. As plantas avasculares são aquelas destituídas de tecidos vasculares. Compõem esse grupo as briófitas e pteridófitas.

16. Plantas vasculares ou traqueófitas possuem vasos formados por células tubulares, especializadas na condução de substâncias nutritivas (seiva) pelo organismo.

Soma das alternativas corretas

11. (UEL) Leia o texto a seguir e responda esta questão.

Christos e espiciarias! – por Cristo e especiarias – foi o grito jubiloso dos marinheiros de Vasco da Gama quando, em maio de 1498, eles se aproximaram da Índia e da meta de ganhar uma fortuna incalculável com condimentos que durante séculos haviam sido monopólio dos mercadores de Veneza. A sua demanda e a das fragrantes moléculas da pimenta, da canela, do cravo-da-índia, da noz-moscada e do gengibre estimularam uma procura global que deu início à Era dos Descobrimentos.

(Adaptado de: COUTEUR, P.; BURRESON, J. Os botões de Napoleão: as 17 moléculas que mudaram a história. Rio de Janeiro: Jorge Zahar, 2006. p.23.)

Assinale a alternativa que apresenta, correta e respectivamente, o órgão da planta utilizado como especiarias: pimenta, canela, cravo-da-índia, noz-moscada e gengibre.

a) Fruto, semente, botão floral, rizoma, tronco.

b) Fruto, tronco, botão floral, semente, rizoma.

c) Rizoma, semente, tronco, botão floral, fruto.

d) Semente, rizoma, fruto, botão floral, tronco.

e) Semente, tronco, botão floral, fruto, rizoma.

12. (UERJ) Desde o início da colonização do ambiente terrestre, houve grande diversificação das plantas, graças ao surgimento de características vantajosas à adaptação, que permitiram a sobrevivência e a reprodução em terra firme. As estruturas correspondentes a adaptações evolutivas exclusivas das plantas, que contribuíram para seu desenvolvimento e diversificação no habitat terrestre, estão indicadas em:

a) Fruto, semente e mitocôndria.

b) Vaso condutor, cutícula e estômato.

c) Membrana celular, cloroplasto e raiz.

d) Meristema apical, parede celular e flor.

13. (UNITAU) Entre as Briófitas, Pteridófitas, Gimnospermas e Angiospermas, a geração dominante é, respectivamente:

a) Gametofítica, esporofítica, esporofítica, esporofítica.

b) Esporofítica, gametofítica, esporofítica, gametofítica.

c) Gametofítica, esporofítica, gametofítica, esporofítica.

d) Esporofítica, esporofítica, esporofítica, gametofítica.

e) Gametofítica, gametofítica, gametofítica, esporofítica.

14. (UNICID) A semente do ipê amarelo, Tabebuia alba, apresenta pequena quantidade de endosperma e baixa durabilidade. Trata-se de uma semente bastante fina e leve, conforme mostra a figura, e não pode ser enterrada para desenvolver seu embrião.

14

A germinação e a dispersão desta semente ocorrem em função, respectivamente, da presença de:

a) Matéria orgânica e insetos.

b) Luz e vento.

c) Minerais e aves.

d) Baixas temperaturas e morcegos.

e) Altas temperaturas e mamíferos.

15. (UFG) Leia as informações a seguir.

Uma árvore, em um ambiente natural a 20oC, apresentando 105 folhas com área média de 0,5 dm2 por folha, está perdendo água para a atmosfera através dos estômatos, em uma média de 5 g/dm2/h, durante o dia.

Dado: Calor latente de vaporização da H2O ≈ 600 cal.

Com base nas informações e considerando-se que esse processo está ocorrendo das 13 às 15 horas, conclui-se que a sua importância e a quantidade de calor absorvido, em cal, são, respectivamente:

a) Síntese de carboidrato e fornecimento de alimento; 1,5∙108.

b) Regulação da temperatura e resfriamento do microambiente; 1,5∙108.

c) Regulação da temperatura e resfriamento do microambiente; 3,0∙108.

d) Consumo de ATP e disponibilização de energia para o metabolismo; 3,0∙107.

e) Consumo de ATP e disponibilização de energia para o metabolismo; 1,5∙107.

16. (UECE) As plantas da caatinga possuem algumas características particulares, como folhas transformadas em espinhos, cutículas altamente impermeáveis, caules suculentos, raízes profundas etc. Essa descrição se refere ao que definimos como:

a) Xeromorfismo.

b) Caducifolia.

c) Convergência adaptativa.

d) Mimetismo.

17. (FATEC) Leia com atenção as afirmações a seguir:

I. A raiz é um órgão geralmente subterrâneo, aclo­rofilado e especializado na fixação da planta e na absorção de água e sais minerais.

II. Quando há uma raiz principal mais desenvolvida que as ramificações, a raiz é dita fasciculada; quando a raiz principal está atrofiada, ela é axial.

III. Raízes adventícias são aquelas originadas do caule ou das folhas.

IV. Raízes respiratórias ou pneumatóforos são raízes encontradas em plantas de mangues, que ficam fora da água e promovem o arejamento da planta.

Dessas afirmações:

a) Apenas a I é correta.

b) Apenas a I, a III e a IV são corretas.

c) Apenas a I e a III são corretas.

d) Apenas a III e a IV são corretas.

e) Todas são corretas.

18. (UEM) Considere as afirmações abaixo e assinale a(s) alternativa(s) correta(s).

01. Beterraba, maçã, tomate e batata-inglesa são exemplos, respectivamente, de raiz tuberosa, pseudofruto, fruto carnoso tipo baga e caule do tipo tubérculo.

02. O colênquima é um tecido de sustentação, formado por células mortas, com paredes espessas e lignificadas.

04. O único fitormônio gasoso, o etileno, atua na indução do amadurecimento de frutos.

08. Os frutos da gimnosperma Araucaria angustifolia ou pinheiro-do-Paraná são comestíveis e popularmente conhecidos como pinhão.

16. Os organismos formadores de mofos, bolores e micoses são autotróficos e armazenam o glicogênio como substância de reserva em suas células.

Soma das alternativas corretas:

19. O esquema a seguir representa a evolução das angiospermas que foi responsável pelo aparecimento do fruto.

19

As estruturas numeradas em 1 e 2 são, respectivamente:

a) Óvulo e ovário.

b) Ovário e óvulo.

c) Fruto e folha carpelar.

d) Fruto e semente.

e) Nervura e ovário.

20. (UFRS) Relacione os tipos de dispersão da coluna I com as adaptações das plantas da coluna II.

COLUNA I

1. Anemocoria

2. Zoocoria

3. Hidrocoria

COLUNA II

(  ) Sementes ou frutos pequenos e leves com um envoltório plumoso.

(  ) Sementes ou frutos dotados de ornamentações.

(  ) Sementes ou frutos com espinhos ou ganchos.

(  ) Sementes ou frutos com estruturas que acumulam ar no seu interior.

(  ) Sementes ou frutos alados.

A sequencia numérica correta, de cima para baixo, na coluna da direita, e

a) 1 – 2 – 2 – 3 – 1.

b) 2 – 1 – 1 – 3 – 2.

c) 1 – 2 – 3 – 3 – 1.

d) 2 – 3 – 3 – 1 – 2.

gab

Publicado por: Djalma Santos | 20 de outubro de 2015

TESTES DE GENÉTICA MOLECULAR (6)

01. (UEM) Sobre material genético, assinale o que for correto.

01. O DNA está presente em todos os seres vivos celulares.

02. É no DNA que se encontra a informação para a síntese de proteínas pela célula.

04. Preservar espécies, para que as mesmas não entrem em extinção, é preservar genes que contêm informações para a síntese de proteínas que poderiam ser úteis ao ser humano.

08. O DNA somente é encontrado no interior do núcleo das células.

16. A célula eucariótica possui DNA mitocondrial e cromatina.

32. Na célula eucariótica, a cromatina é encontrada nos cloroplastos.

64. Os vírus não possuem DNA e se utilizam do DNA da célula infectada para a síntese de suas proteínas.

Soma das alternativas corretas:

02.  (UERJ) Considere uma célula bacteriana com quatro guaninas oxidadas em um trecho do gene que codifica determinada proteína, conforme mostra a sequência:

G*CG* – CCC – TG*T – ACG* – ATA

Ao final de certo tempo, essa célula, ao dividir-se, dá origem a uma população de bactérias mutantes. O número máximo de aminoácidos diferentes que poderão ser substituídos na proteína sintetizada por essas bactérias, a partir da sequência de DNA apresentada, é igual a:

a) 0.

b) 1.

c) 2.

d) 3.

03. (PISM) O esquema abaixo representa a síntese proteica realizada por polirribossomos livres de uma célula eucariota. Analise-o e assinale a opção correta:

03

a) O RNAm contém a informação genética transcrita a partir do RNAr.

b) O polirribossomo livre é um componente celular especializado na síntese de glicoproteínas.

c) No polirribossomo livre, o processo de síntese proteica não requer a presença de RNAt.

d) A presença de vários ribossomos ao longo do RNAm evidencia a produção de moléculas idênticas de uma mesma proteína.

e) As proteínas livres na matriz citoplasmática são encaminhadas aos centríolos para serem degradadas.

04. (IFG) […] Os erros inatos do metabolismo são distúrbios de natureza genética que geralmente correspondem a um defeito enzimático capaz de acarretar a interrupção de uma via metabólica.

Disponível em: <http://www.folhape.com.br/cms/opencms/folhape/pt/cotidiano/saude/arquivo s/2011/outubro/0415.html>. Acesso em: 10 dez. 2012.

Sobre os erros inatos do metabolismo, considere as seguintes afirmativas:

I. Podem levar a falhas na síntese, degradação, armazenamento ou transporte de moléculas no organismo.

II. Tais erros do metabolismo são considerados a causa das Doenças Metabólicas Hereditárias.

III. As doenças metabólicas são ocasionadas pelo acúmulo de produtos gerados após a reação entre enzima e substrato.

Somente está(ão) correta(s):

a) A afirmativa I.

b) A afirmativa II.

c) As afirmativas I e II.

d) As afirmativas I e III.

e) As afirmativas II e III.

05. (UFSC) Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade, engenharia genética, transgênicos, clonagem terapêutica e reprodutiva, terapia gênica, farmacogenômica etc. Para compreender essas notícias, é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento. Analise os dados dos quadros a seguir, e assinale a(s) proposição(ões) correta(s).

05

01. Em I, observa-se que o pareamento das bases nitrogenadas do DNA é aleatório.

02. O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa, pois cada uma das fitas originais em I serve de molde para uma nova fita, gerando duas novas duplas hélices.

04. Em II, está indicado o processo de transcrição, através do qual se formam moléculas que contêm as mesmas bases nitrogenadas presentes no DNA.

08. Em III, está indicado o processo de tradução, que resulta na formação de polipeptídios, cuja sequência de aminoácidos está codificada numa molécula de ácido nucleico.

16. A deleção de um dos pares de bases na sequência mostrada em I não alteraria significativamente a sequência de aminoácidos em III.

Soma das alternativas corretas:

06. (UFU) A análise de um segmento do DNA de um procarioto revelou a seguinte sequência de nucleotídeos: AGG GAC TTC CTT GCT ATC.

06

Com base na tabela de códons e seus respectivos aminoácidos, pode-se afirmar que a sequência polipeptídica, após a tradução, será representada pelos seguintes aminoácidos:

a) Serina, Leucina, Lisina, Ácido glutâmico e Arginina.

b) Arginina, Ácido aspártico, Tirosina, Alanina, Isoleucina e Glicina.

c) Cisteína, Leucina, Serina e Treonina.

d) Valina, Histidina, Glutamina, Serina, Alanina e Glicina.

07. (UFPel)

07

As bactérias apresentam reprodução assexuada, o que permite que uma bactéria origine duas novas idênticas a ela. Entretanto, muitas bactérias apresentam ainda a capacidade de realizar troca de genes. De acordo com seus conhecimentos e com as informações dos textos, é correto afirmar que:

a) A figura A representa a reprodução assexuada por divisão binária, em que a célula bacteriana divide o seu cromossomo, originando duas novas bactérias com metade do DNA original; a figura B representa o processo de transferência de pedaços de DNA os quais passam diretamente de uma bactéria doadora para uma bactéria receptora.

b) A figura A representa o processo de reprodução sexuada que ocorre em muitas bactérias, em que, a partir de uma célula bacteriana, duas novas, com características genéticas diferentes, são formadas; a figura B representa um processo de transformação bacteriana em que a bactéria absorve moléculas de DNA dispersas no meio.

c) O modo de reprodução da bactéria representada na figura A garante uma maior variabilidade genética do que o da representada na figura B, pois naquela ocorreu o processo de transferência de DNA, o que permitiu a troca de material genético entre as bactérias.

d) O modo de reprodução da bactéria representada na figura B garante uma maior variabilidade genética do que o da representada na figura A, pois naquela ocorreu o processo de troca de material genético de uma bactéria para a outra, através da ação de uma terceira bactéria que transporta o DNA.

e) A figura A representa a reprodução assexuada por divisão binária, em que a célula bacteriana duplica seu cromossomo e se divide; a figura B representa um processo que envolve a transferência de moléculas de DNA de uma bactéria para outra, por meio de vírus bacteriófago.

08. (IFTM) Se fosse possível sintetizar in vitro uma proteína, nas mesmas condições em que essa síntese ocorre nas células, utilizando-se ribossomos obtidos de células de preá do cerrado de Goiás, RNA mensageiro de células de camundongo do brejo de Mato Grosso do Sul, RNA transportador de células de sagui do Mata Atlântica no Espírito Santo e aminoácidos ativados de célula bacteriana coletada na lagoa da Pampulha em Belo Horizonte, a proteína produzida teria a estrutura primária (sequência de aminoácidos) idêntica à:

a) Não seria possível, pois os sistemas enzimáticos e celulares são peculiares a cada espécie.

b) Uma mistura de todas as células.

c) Do sagui.

d) Do preá.

e) Do camundongo do brejo.

09. (UFSJ) Martha Chase, nascida em 1927 na cidade de Cleveland, nos Estados Unidos da América, foi uma importante geneticista de nosso século ao contribuir significativamente na compreensão do processo de hereditariedade. Ela foi coautora do trabalho com Alfred Hershey (1908-1997), publicado em 1952. Na época, ela era assistente de laboratório na Universidade da Carolina do Sul. O experimento, conhecido como o “Experimento do Liquidificador”, foi elaborado para responder a uma questão bastante presente na época. Já há algumas décadas os cientistas se dedicavam ao estudo de certo tipo de vírus (bacteriófagos ou fagos) que infectava bactérias para se reproduzir. Com esses estudos os cientistas procuravam avançar na compreensão das moléculas envolvidas na transmissão de características genéticas. A pergunta da época, de Martha Chase, era: qual é o componente que permite a reprodução dos vírus bacteriófagos (ou fagos)? Isso porque esses vírus são organismos bem simples, compostos basicamente de uma molécula de DNA e uma cápsula de proteína. Então: Qual dessas duas estruturas estaria envolvida na reprodução? Martha Chase participou dos experimentos no grupo de Hershey. Eles adicionaram fagos com marcação diferencial no DNA e na cápsula proteica a uma cultura de bactérias, permitindo que os vírus infectassem as bactérias. Então, eles agitaram essa mistura de vírus e bactéria em um liquidificador bem controlado para separar os vírus das bactérias sem estourar as membranas celulares delas. Ao final do experimento, Hershey e Chase examinaram apenas as bactérias separadas, procurando as porções marcadas. Eles encontraram dentro da bactéria partes marcadas do DNA do vírus e não encontraram partes marcadas da cápsula proteica do vírus. “Esses resultados permitiram concluir que apenas o DNA do fago penetra na bactéria quando ocorre a infecção e que, a partir do DNA, é produzida toda uma geração de novos fagos com DNA e proteínas típicos da espécie de fagos utilizada. Portanto, podia-se concluir que a fonte das informações hereditárias é o DNA, pois, a partir dele, pode-se produzir tanto DNA quanto proteínas virais.”

                                                                                                                                         Disponível em: http://www.biomol.org/historia/identiffagos.shtml

Sobre as conclusões do experimento de Hershey e Chase, é incorreto afirmar que:

a) Para as conclusões, foram consideradas apenas as porções marcadas de cápsula proteica e DNA virais presentes nas bactérias não lizadas.

b) Para se reproduzirem, os fagos injetaram apenas seu DNA nas bactérias e, a partir do DNA viral, produziram DNA e proteínas virais.

c) Para o experimento, foram selecionadas as bactérias infectadas que não foram lizadas pelos fagos.

d) Ao invadir as bactérias, os fagos incorporaram o DNA das bactérias para reproduzir seu material genético.

10. (IFNMG) Imagine a seguinte situação hipotética: Um aluno precisa decifrar o código de uma enzima R20, que possui uma cadeia de aminoácidos desconhecidos. Para que esses aminoácidos fossem decifrados, foi dada ao aluno uma tabela com as seguintes informações:

10

Fonte: https://djalmasantos.wordpress.com/2010/11/15/

codigo-genetico. Acesso em 25/06/2012.

Continuando o raciocínio, foi repassada ao aluno a informação de que o gene da R20 estava inserido na seguinte sequência de DNA (sabendo-se que o DNA é uma molécula de dupla hélice, foi apresentada somente uma de suas cadeias polinucleotídicas na qual se encontra o gene):

TAA-ACG-TAC-CCG-GGC-TTA-TTC-AAA-CCC-ATT-CAC-TTT

A cadeia do gene sempre se iniciaria quando fosse detectado o códon AUG (códon de início) e terminaria com um códon de parada (ou códon de fim). Com base nas informações contidas na questão e em seus conhecimentos sobre o assunto, a sequência correta de aminoácidos que correspondem à enzima citada é:

a) ILE; CIS; MET; GLI; PRO; ASN; LIS; FEN; ARG; códon de fim.

b) MET; ASN; PRO; GLI; LIS; FEN; ARG; códon de fim.

c) MET; GLI; PRO; ASN; LIS; FEN; GLI; códon de fim.

d) MET; GLI; FEN; ASN; LIS; PRO; ARG; códon de fim.

11. (UNEAL) Muito tem sido aprendido sobre como as instruções genéticas escritas em um alfabeto de apenas 4 “letras” – os quatros diferentes nucleotídeos de DNA – direcionam os processos subcelulares. Em relação ao fluxo da informação genética, enumere a segunda coluna de acordo com a primeira.

1a COLUNA

1. Transcrição

2. Tradução

3. Splicing

4. Replicação

5. Capeamento de precursores de RNAm

2a COLUNA

(  ) Processo catalisado pela DNA polimerase.

( ) Processo que consiste na adição de um “quepe” (7-metilguanosina) a extremidade 5’ de determinados transcritos primários.

(  ) Processo que envolve atividade de peptidil transferase.

(  ) Processo catalisado pela RNA polimerase.

(  ) Processo que consiste na remoção dos introns e junção dos éxons.

Qual a sequência correta, de cima para baixo?

a) 4 – 5 – 2 – 3 – 1.

b) 5 – 4 – 1 – 2 – 3.

c) 3 – 1 – 4 – 2 – 5.

d) 4 – 5 – 2 – 1 – 3.

e) 2 – 1 – 3 – 5 – 4.

12. (UFAM) Em 1928, Fred Griffith trabalhava com bactérias da espécie Diplococcus pneumoniae, onde algumas colônias causavam pneumonia e eram ditas virulentas e outras não tinham essa capacidade (portanto, não virulentas). As colônias virulentas eram chamadas de bactérias S (devido a uma camada de polissacarídeos em sua superfície que as deixavam com uma aparência lisa, do inglês smooth). A colônia não virulenta apresentava uma aparência mais rugosa (bactérias R). Ambas as colônias foram processadas e inoculadas em ratos conforme o protocolo a seguir:

12

A partir da figura fornecida, é correto afirmar que:

a) Os ratos inoculados com as bactérias S só contraíram pneumonia, mas não morreram.

b) As bactérias R foram as responsáveis pelas mortes dos ratos no experimento em que as duas colônias foram inoculadas simultaneamente.

c) A passagem de proteínas de uma colônia para a outra resultou na transformação da colônia R em virulenta.

d) As bactérias R são mais virulentas do que as bactérias S.

e) A transformação de bactérias não virulentas em virulentas só é possível devido à passagem e incorporação de material genético das bactérias S para as bactérias R, transformando-as.

13. (OBJETIVO-SP) A ANVISA (Agência Nacional de Vigilância Sanitária) normatizou, recentemente, a utilização de câmaras de bronzeamento artificial, visando diminuir os riscos dessa prática, tais como lesões na retina, queimaduras, envelhecimento precoce e câncer de pele. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento, com duração de 15 a 30 minutos cada uma, apresentou, quatro meses depois, indícios de câncer de pele, uma vez que as radiações UV danificaram seu DNA. Pode-se afirmar que esse tipo de câncer:

a) É herdável, porque provoca alteração do DNA.

b) Não é herdável, porque a mutação resultante é recessiva.

c) É herdável, porque a mutação resultante é dominante.

d) Não é herdável, porque provoca alteração em células somáticas.

e) É herdável, porque provoca alteração em células germinativas.

14. (UFSJ) Do DNA às Proteínas: seguindo as instruções no código genético.

“As instruções para suas características, do nível celular ao nível do seu corpo inteiro, estão codificadas no seu DNA. Sempre que suas células se dividem (1) para fazer novas células, elas precisam copiar seu DNA, pelo processo de replicação de DNA, para que cada nova célula tenha seu conjunto de instruções. As células ativas do seu corpo estão constantemente lendo o código genético e utilizando as instruções para construir moléculas, como as proteínas, utilizadas para realizar as tarefas do corpo. Proteínas são construídas pelo esforço combinado de dois processos: transcrição e tradução.

Sinais, como os hormônios, podem dizer às suas células ativas que elas precisam mudar seu comportamento (2). Para mudar seu comportamento, suas células podem precisar mudar suas ferramentas. A regulação dos genes permite que as células desliguem alguns genes e liguem outros para a produção de proteínas. Na verdade, como suas instruções usam o DNA é tão importante quanto o que o código diz.”

(KRATZ, René Fester. Molecular and cell biology for dummies. Indianapolis: Wiley, 2009)

Sobre o texto, é correto afirmar que:

a) Pode-se dizer que as suas características morfológicas expressas, ou seja, seu fenótipo, e o seu comportamento celular, que distinguem um ser humano de outro, estão intimamente ligadas à combinação de genes que são ativados ou desativados no seu nascimento e que permanecem ativo ou inativos durante toda sua vida.

b) Cada indivíduo é único por apresentar um conjunto distinto de genes; assim, suas características morfológicas, desde o nível celular até seu corpo inteiro, o fazem diferente de outros humanos pela peculiaridade genômica.

c) A divisão celular, descrita na frase 1 em negrito, refere-se tanto à meiose quanto à mitose, pois ambas são processos de divisão celular que mantêm o genoma.

d) A mudança de comportamento exposta na frase em negrito assinalada pelo número 2 pode ser, por exemplo, o início da produção de um hormônio pela ativação da maquinaria nuclear e citoplasmática de síntese proteica.

15. (UFRR) Algumas das principais terapias contra o HIV, o retrovírus causador da AIDS, têm como alvo uma enzima exclusiva do vírus, a transcriptase reversa, que catalisa uma reação inexistente em células eucarióticas. Esse tipo de abordagem tem o intuito de evitar efeitos colaterais sobre o metabolismo celular. Assinale a opção que identifica, corretamente, a função dessa enzima.

a) Transcrever o RNA viral em um peptídeo.

b) Transcrever o RNA viral em outra molécula de RNA.

c) Transcrever o DNA viral em uma molécula de RNA.

d) Transcrever o RNA viral em uma molécula de DNA.

e) Transcrever o DNA viral em um peptídeo.

16. (UFSM) O problema da desnutrição é mundial. Um pesquisador conseguiu uma nova variedade de feijão muito mais nutritiva. Para isso, ele precisou alterar o DNA responsável pela informação necessária à síntese da proteína faseolina. A seguir, estão representados, respectivamente, parte da sequência de códons e eles mesmos, após a mutação obtida.

16a

Informe qual fita de DNA deu origem à sequência mutante.

16b

17. (UFSC) Segundo o site Scientific Reports, ligado à revista Nature, o desastre nuclear de Fukushima, ocorrido após o terremoto de 11 de março de 2011, já mostra efeitos na fauna local do nordeste japonês. Cientistas encontraram borboletas que sofreram mutações (foto abaixo) devido à radiação liberada pelos reatores danificados da usina.

17

Disponível em: <http://blogs.estadao.com.br/radar-cientifico/2012/08/14/borboletas-mutantes-sao-encontradas-na-

regiao-de-fukushima/>. [Adaptado] Acesso em: 12 set. 2012.

Considerando o exposto acima, assinale a(s) proposição(ões) correta(s).

01. As mutações originadas pela radiação nas borboletas em Fukushima, citadas no artigo, restringem-se aos fenótipos e não afetaram seus genótipos.

02. Segundo Darwin, em seu célebre livro A Origem das Espécies por meio da Seleção Natural, as mutações são o principal agente de variabilidade entre as espécies.

04. As mutações gênicas e a recombinação gênica contribuem para a variabilidade genética das populações.

08. Uma mutação só ocorre quando envolve a mudança de um códon no DNA.

16. Mutações somente ocorrem em algumas regiões da cadeia de DNA.

32. Todas as mutações são perceptíveis no fenótipo dos indivíduos que as possuem.

64. Apesar de ocorrerem muitas mutações ao longo da cadeia de DNA, elas podem ser corrigidas por mecanismos que envolvem enzimas especializadas no reparo.

Soma das alternativas corretas:

18. (UFF) “Após o anúncio histórico da criação de vida artificial no laboratório do geneticista Craig Venter o – mesmo responsável pela decodificação do genoma humano em 2001-, o presidente dos EUA, Barack Obama, pediu a seus conselheiros especializados em biotecnologia para analisarem as consequências e as implicações da nova técnica.”

                                                                                                                                                                                             (O Globo on line, 22/05/2010)

A experiência de Venter ainda não explica como a vida começou, mas reforça novamente que, sob determinadas condições, fragmentos químicos são unidos para formar a principal molécula responsável pelo código genético da vida. Para a síntese de uma molécula de DNA em laboratório, a partir de uma fita molde de DNA, além do primer, deve-se utilizar:

a) Nucleotídeos de Timina, Citosina, Guanina e Adenina; DNA e RNA polimerase.

b) Nucleotídeos de Timina, Citosina, Guanina e Uracila; e DNA polimerase.

c) Nucleotídeos de Timina, Citosina, Guanina e Adenina; e DNA polimerase.

d) Nucleotídeos de Timina, Citosina, Guanina e Uracila; e RNA polimerase.

e) Nucleotídeos de Timina, Citosina, Guanina, Uracila e Adenina; e DNA polimerase.

19. (UFTM) O esquema ilustra um processo que ocorre em certas bactérias.

19

O mecanismo é conhecido como:

a) Transformação, que resulta em modificação genética, podendo aumentar a chance de sobrevivência.

b) Permutação, que consiste na fusão de material genético diferente do original.

c) Transdução, que consiste em receber um segmento de DNA exógeno, resultando um ser transgênico.

d) Bipartição, que possibilita a formação de um indivíduo geneticamente mais complexo.

e) Conjugação, que aumenta a variabilidade genética das espécies que a realizam.

20. (UNIMONTES) As propriedades biológicas e funcionais de um organismo são determinadas pelo conjunto de interações que ocorrem entre os seus componentes, desde interações moleculares até interações com outros organismos. O estudo de sistemas biológicos sob esse ponto de vista é chamado de biologia de sistema, sua base e estudar os sistemas biológicos como um todo, e não individualmente, para as pequenas partes que os compõem. Assim, foram surgindo os projetos “OMAS”, cujos materiais de pesquisa estão representados na figura a seguir. Observe-a.

20

Considerando a figura e o assunto relacionado com ela, analise as afirmativas abaixo e assinale a alternativa incorreta.

a) O genoma é o conjunto de informações contidas no DNA.

b) O transcriptoma é a análise dos RNAs presentes.

c) O metaboloma é o mais simples de todos, pois não interfere na expressão dos genes.

d) O proteoma permite avaliar as modificações pós-traducionais sofridas por um gene.

gab

 

 

 

Publicado por: Djalma Santos | 19 de outubro de 2015

TESTES DE BIOTECNOLOGIA (V)

01. (ANGLO-SP) Cientistas coreanos realizaram a clonagem de embriões humanos, permitindo seu desenvolvimento até uma fase em que foi possível extrair deles células com o potencial de se transformarem em qualquer tipo de tecido do corpo humano. No processo, núcleos de células somáticas (não reprodutoras) de 16 doadoras foram transferidos para ovócitos sem núcleo (células precursoras dos óvulos) retirados das mesmas doadoras. Após a transferência, do total de 242 ovócitos utilizados, apenas 20 originaram blastocistos (embriões com várias células). Destes foram retiradas células que se diferenciaram nos três tipos básicos de tecidos embrionários, que originam todos os outros tecidos do corpo. A partir dos dados apresentados, podemos concluir que essa técnica, uma vez aperfeiçoada, tornará viável:

a) A formação de híbridos entre seres humanos e outros animais, como ovelhas.

b) O desenvolvimento de crianças em incubadoras, sem a participação dos pais.

c) A obtenção de tecidos usados em transplantes para corrigir doenças degenerativas.

d) A produção de animais transgênicos dotados de genes humanos somáticos.

e) O tratamento de doenças genéticas através da modificação das células somáticas.

02. (UEFS) Os estudos que estão sendo conhecidos como Avaliações na Escala das Fazendas de Plantas Tolerantes a Herbicidas por Modificação Genética, comparam campos de plantações geneticamente modificados, GM de colza e beterraba, com campos adjacentes nas mesmas plantações não GM para ver o que acontecia com a biodiversidade. (…) Os campos onde a colza GM crescia atinha 30% menos de borboletas, 70% menos ervas e cinco vezes menos sementes disponíveis para a alimentação de animais silvestres que os campos de colza não GM. Os campos de beterraba não GM mostravam 1,3 vezes mais ervas e três mais sementes de outras plantas silvestres que alimentam pássaros e insetos, além de 1,4 vezes mais borboletas e 40% mais flores em suas margens, quando comparadas aos campos de plantação de beterraba GM.

(Cesário. In Scientific American, p.27)

Uma interpretação dos dados que comparam campos de plantações GM de colza e de beterraba com campos adjacentes das mesmas plantações não GM permite considerar:

a) Colza e beterraba, geneticamente modificadas, impedem o crescimento das demais espécies quando não tratadas com herbicidas específicos.

b) O efeito dos herbicidas é mais imediato em populações de insetos.

c) A dispersão de espécies vegetais está mais assegurada em campos de plantações não GM.

d) As relações simbióticas entre insetos e plantas com flores são mais preservadas nos campos GM.

e) O cultivo de plantas geneticamente modificadas aumenta intensamente a competição entre espécies silvestres.

03. (ENADE) A poluição em ambientes aquáticos pode ser evidenciada com a utilização de uma linhagem transgênica do peixe paulistinha (Danio rerio). Essa linhagem apresenta um gene da luciferase, originário de uma água-viva, que é ativado em resposta a determinados poluentes. Em situação experimental, o peixe vivo muda de cor na presença do poluente e depois, ao ser colocado em água limpa, volta à coloração original e pode ser reutilizado inúmeras vezes.

CARVAN, M. J. et al. Transgenic zebrafish as sentinels for aquatic pollution.  In:  Annals of the New York Academy of Sciences, 919133-47, 2000 (com adaptações).

Com relação ao fenômeno descrito no texto, é correto afirmar que a mudança na coloração do peixe:

a) Decorre de alterações em moléculas de RNA que não chegam a afetar os genes do animal.

b) É um fenômeno que ocorre com frequência em animais transgênicos, mesmo que estes não tenham o gene da luciferase.

c) Decorre da ação de genes constitutivos que são ativados por fatores ambientais.

d) É um exemplo de como fatores ambientais podem regular o funcionamento de um gene.

e) É o resultado de eventos mutacionais, como quebras cromossômicas ou alterações gênicas.

04. (UFSM) Em junho de 2000, foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a sequência de, aproximadamente, três bilhões de nucleotídeos do genoma humano. O conhecimento dessas sequências permitirá determinar:

a) O número de cromossomos presentes nas células humanas.

b) O número de proteínas que compõem os genes humanos.

c) Quantas moléculas de DNA estão presentes nos cromossomos humanos.

d) O número de doenças que podem afligir a humanidade.

e) O número total de genes humanos e quais as proteínas codificadas por esses genes.

05. (UNESP) Suponha que o seguinte experimento pudesse ser realizado. O óvulo enucleado de uma vaca recebeu o núcleo de dois espermatozoides de um mesmo touro. Esses núcleos fundiram-se, e a célula resultante comportou-se como um zigoto, que se dividiu nos primeiros blastômeros e foi implantado no útero de outra vaca. Ao final da gestação, nasceu um animal que:

a) Obrigatoriamente é do sexo masculino.

b) É homozigoto para todos os seus genes.

c) Pode ser macho ou fêmea e ter características diferentes das do seu pai.

d) Tem apenas um lote haploide de cromossomos por célula.

e) É clone de seu pai.

06. (OBJETIVO-SP) Um pesquisador, após um trabalho de melhoramento genético, obteve uma variedade de plantas cujas flores têm grande valor comercial. Na reprodução dessa variedade de plantas e na manutenção das características selecionadas, o cientista deve realizar:

a) Plantio das sementes obtidas por cruzamento entre plantas híbridas.

b) Retrocruzamento da variedade com plantas homozigotas ou heterozigotas.

c) Retirada dos estames das flores para garantir a fecundação cruzada.

d) Produção de mudas através de métodos assexuados, como, por exemplo, a estaquia de caule.

e) Propagação de sementes obtidas por cruzamento com a espécie selvagem.

07. (ANGLO-SP) Durante muito tempo, os cientistas acreditaram que variações anatômicas entre os animais fossem consequência de diferenças significativas entre seus genomas. Porém, os projetos de sequenciamento de genoma revelaram o contrário. Hoje, sabe-se que 99% do genoma de um camundongo é igual ao do homem, apesar das notáveis diferenças entre eles. Sabe-se também que os genes ocupam apenas cerca de 1,5% do DNA e que menos de 10% dos genes codificam proteínas que atuam na construção e na definição das formas do corpo. O restante, possivelmente, constitui DNA não codificante. Como explicar, então, as diferenças fenotípicas entre as diversas espécies animais? A resposta pode estar na região não codificante do DNA.

S. B. Carroll et al. O jogo da evolução. In: Scientific American Brasil, jun./2008 (com adaptações).

A região não codificaste do DNA pode ser responsável pelas diferenças marcantes no fenótipo porque contém:

a) As sequências de DNA que codificam proteínas responsáveis pela definição das formas do corpo.

b) Uma enzima que sintetiza proteínas a partir da sequência de aminoácidos que formam o gene.

c) Centenas de aminoácidos que compõem a maioria de nossas proteínas.

d) Informações que, apesar de não serem traduzidas em sequências de aminoácidos, interferem no fenótipo.

e) Os genes associados à formação de estruturas similares às de outras espécies.

08. (UFOP) LEIA O TEXTO A SEGUIR:

“As discussões sobre os organismos geneticamente modificados, no mundo e no Brasil, ultrapassaram os limites da área científica: o foco da polêmica está hoje nas questões econômicas, políticas e ideológicas relacionadas aos transgênicos. No país, a polarização político-ideológica do tema ainda impede uma análise mais imparcial, em que pesem as reais vantagens e desvantagens do uso dessa nova biotecnologia, na qual a bioética terá um papel fundamental.”

(GUERRANTE, R. S. Opinião – Política  e ideologia no debate dos transgênicos. Ciência Hoje, 177, Nov. 2001. Adaptação.)

Assinale a proposição verdadeira sobre a transgenia e consequências para a saúde e o meio ambiente.

a) Os cientistas interferem na evolução natural das espécies, alterando geneticamente animais e plantas.

b) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie.

c) Os genes alienígenas não fazem com que o organismo receptor produza substâncias diferentes daquelas que produziriam em condições naturais.

d) As plantas transgênicas podem ser obtidas pelo processo de enxertia de uma região do tecido meristemático de uma planta em outra diferente.

09. (UEFS) Os estudos que estão sendo conhecidos como Avaliações na Escala das Fazendas de Plantas Tolerantes a Herbicidas por Modificação Genética, comparam campos de plantações geneticamente modificados, GM de colza e beterraba, com campos adjacentes nas mesmas plantações não GM para ver o que acontecia com a biodiversidade. (…) Os campos onde a colza GM crescia atinha 30% menos de borboletas, 70% menos ervas e cinco vezes menos sementes disponíveis para a alimentação de animais silvestres que os campos de colza não GM. Os campos de beterraba não GM mostravam 1,3 vezes mais ervas e três mais sementes de outras plantas silvestres que alimentam pássaros e insetos, além de 1,4 vezes mais borboletas e 40% mais flores em suas margens, quando comparadas aos campos de plantação de beterraba GM.

(Cesário. In Scientific American, p.27)

Uma análise da situação, em uma abordagem evolutiva, permite prever como repercussão sobre a biodiversidade:

a) Redução do número de indivíduos como o único efeito sobre as comunidades estabelecidas.

b) Herbicidas de largo espectro podendo ser usados em plantações mistas GM e não GM com efeitos equivalentes.

c) Seleção de organismos mais resistentes, favorecendo a obtenção de pool gênico com maior variabilidade genética.

d) Pesquisas fitoterápicas fortemente incrementadas em função da sobrevivência de plantas de maior potencial medicamentoso.

e) Risco cada vez mais próximo de o homem ter de sustentar uma vida cada vez menos natural.

10. (PUC-SP) “No ano seguinte (…) iniciaram-se as obras em Isla Nublar. Isso incluía terraplanagem em larga escala inclusive para a construção de um lago raso, com três quilômetros de comprimento, no centro da ilha. Os planos para a construção de um complexo turístico foram levados adiante, cercados do maior sigilo. Mas parece que a InGen de fato construiu um enorme zoológico na Ilha.

Um dos diretores inclinou-se para frente:

– E daí, senhor Dodgson?

– Não se trata de um zoológico comum – Dodgson explicou – Esse zoológico é o único do mundo no gênero. Ao que parece, a InGen conseguiu algo realmente extraordinário. Eles tiverem sucesso na tentativa de clonar animais do passado.

– Que animais?

– Dinossauro – Dodgson revelou.

– Eles conseguiram gerar dinossauros através de clonagem.”

(Trecho de “O Parque dos Dinossauros”, Michael Crichton, Editora Best Seller, SP – l992).

O termo clonagem, conforme foi mencionado no texto, refere-se a uma técnica cada vez mais usada em Biotecnologia. Basicamente, pode-se dizer que clonagem é a:

a) Multiplicação de animais a partir de uma única célula diploide.

b) Multiplicação de animais a partir de uma única célula haploide.

c) Reprodução de um animal inteiro, utilizando-se células haploides masculinas e femininas.

d) Modificação da espécie a partir da manipulação de seu código genético.

e) Reanimação de animais encontrados congelados em geleiras.

11. (UFV) O exame de paternidade tem sido muito utilizado na medicina forense. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe, do pai e dos filhos. O resultado do teste, representado a seguir, contém padrões dessas marcas de uma determinada família.

11

Com base neste resultado, assinale a alternativa incorreta:

a) I é filho biológico do casal.

b) II não é filho deste pai.

c) V não pode ser filho biológico deste casal.

d) IV pode ser filho adotivo do casal.

e) III é irmão biológico de I.

12. (ANGLO-SP)

ANALISANDO O TEXTO ABAIXO, RESPONDA A ESTA QUESTÃO.

Um organismo transgênico é aquele que recebeu genes de outra espécie, por técnicas de engenharia genética, e que consegue expressar esses genes. Os vegetais transgênicos, por exemplo, recebem genes que aumentam a sua produtividade e a sua resistência a pragas e ao frio, entre outras coisas. Os genes transferidos são obtidos de bactérias, de outras espécies vegetais ou mesmo de espécies animais. Embora existam restrições de ordem econômica e eventuais riscos ecológicos, muitas variedades de plantas geneticamente modificadas vêm sendo produzidas; a maioria ainda está em fase de testes, mas algumas já são comercializadas, como tomates, batatas, soja, trigo e milho transgênicos.

Para o homem, a principal vantagem da produção de organismos transgênicos consiste em:

a) Obter organismos modificados favoravelmente pela ação de genes recebidos de outras espécies.

b) Transformar espécies vegetais em espécies animais resistentes a pragas.

c) Produzir genes resistentes a pragas por técnicas de engenharia genética.

d) Formar cópias idênticas de determinado organismo com características favoráveis, a partir do uso de células corporais.

e) Desenvolver novos tipos de organismos, obtidos por meio da fusão natural de duas espécies diferentes.

13. (UEL) A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento, que são administrados a pacientes de todo o planeta. Sobre a produção de organismos geneticamente modificados, é correto afirmar:

a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos.

b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores proteicos conhecidos como plasmídeos.

c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais.

d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais.

e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares.

14. (UFES) “O genoma humano foi mapeado e sua sequência estabelecida pela primeira vez na historia da humanidade, anunciaram ontem o presidente norte-americano, Bill Clinton, o primeiro ministro britânico Tony Blair, e os representantes dos grupos rivais, o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera”.

                         “Folha Ciência”, São Paulo – 27/06/2000.

Leia as proposições a seguir sobre o Projeto Genoma Humano.

I. O sequenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes.

II. O genoma humano pode ser sequenciado a partir de qualquer célula do corpo, com exceção das hemácias.

III. O sequenciamento do genoma humano determinou a posição exata e a função de cada gene, possibilitando a melhor compreensão dos diferentes fenótipos.

IV. O sequenciamento do genoma de outras espécies, como o das bactérias (Xiylela fastidiosa), dos camundongos e ratos, é de grande auxilio para o Projeto Genoma Humano.

Considerando as proposições anteriores, pode-se afirmar que estão corretas:

a) Apenas I e II.

b) Apenas II e III.

c) Apenas I, III e IV.

d) Apenas I, II e IV.

e) Todas as proposições.

15. (UNIFESP) Nos exames para teste de paternidade, o DNA, quando extraído do sangue, é obtido:

a) Das hemácias e dos leucócitos, mas não do plasma.

b) Das hemácias, dos leucócitos e do plasma.

c) Das hemácias, o principal componente do sangue.

d) Dos leucócitos, principais células de defesa do sangue.

e) Dos leucócitos e das globulinas, mas não das hemácias.

16. (UFBA) A figura abaixo expressa simbolicamente a contribuição da biologia molecular no conhecimento atual dos genomas e sua aplicação em biotecnologia. As técnicas de análise do DNA incluem a obtenção de padrões de distribuição de segmentos de desoxirribonucleotídeos submetidos a eletroforese, como os observados na figura. Constituem exemplos da utilização dessas técnicas as investigações de paternidade, criminalidade e análises comparativas de espécies e populações em estudos de genética e evolução.

16

Sobre a base teórica que sustenta os estudos sugeridos pela ilustração, pode-se afirmar:

01. O material genético ocorre, preferencialmente, em determinados órgãos e tecidos de um sistema biológico.

02. O DNA é a molécula informacional que fundamenta a diversidade do mundo vivo.

04. A estrutura molecular do DNA e seu mecanismo de replicação constituem a base da hereditariedade.

08. A informação genética é inerente à sequência de nucleotídeos ao longo da molécula de DNA.

16. A expressão do genótipo se concretiza pela tradução da mensagem genética na forma de cadeias polipeptídicas em um ambiente específico.

32. Os genomas estão organizados em fragmentos de moléculas de DNA dispersos na célula.

64. Diferentes padrões de bandas resultam de sequências nucleotídicas características de cada indivíduo.

Soma das alternativas corretas:

17. (UFPel) Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação, para cultivo comercial, de plantas transgênicas. A obtenção dessas plantas se deve à biotecnologia.

“A biotecnologia de genética molecular foi inicialmente aplicada a micróbios, mas hoje as mesmas técnicas estão sendo aplicadas a plantas e animais, resultando em tipos criados que nunca poderiam ser produzidos com a genética clássica. (…) Com a capacidade de mover genes de um organismo para outro, os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes; plantas que adquiriram resistência ao frio por expressar os genes anticongelantes de peixes, e camundongos gigantes que expressam os genes do hormônio de crescimento de ratos”.

O texto acima se refere a organismos transgênicos, que são aqueles em cujo material genético foi introduzido um gene de outra espécie ou mesmo um gene produzido em laboratório. Assinale a alternativa que define o que é um gene.

a) Um gene é um cromossomo da célula vegetal ou animal.

b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada cadeia proteica.

c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica.

d) Um gene é uma cadeia de aminoácidos que codifica o código genético.

18. (FUVEST) Enzimas de restrição são fundamentais à engenharia genética porque permitem:

a) A passagem de DNA através da parede celular.

b) Inibir a síntese de RNA a partir de DNA.

c) Inibir a síntese de DNA a partir de RNA.

d) Cortar o DNA onde ocorrem sequências específicas de bases.

e) Modificar a sequência de bases do DNA.

19. (ANGLO-SP) Já se passaram 50 anos desde que Watson e Crick elucidaram a estrutura espacial da molécula de DNA, material genético da maioria dos seres vivos. Desde então, foram feitos incríveis progressos na compreensão da natureza dos genes e de seu mecanismo de ação. Assim, no dia 14/04/2003, os meios de comunicação noticiaram o encerramento do Projeto Genoma Humano, alguns anos antes da previsão inicial. Esse projeto, no qual colaboraram cientistas do mundo inteiro, inclusive do Brasil, conseguiu desvendar:

a) O fato de que os genes se localizam, realmente, nos cromossomos.

b) A sequência de todos os genes ao longo dos cromossomos do homem.

c) Toda a diversidade de proteínas produzidas pelos genes humanos.

d) A sequência completa das quatro bases nitrogenadas do código genético (A, T, C e G), ao longo do material genético.

e) As doenças causadas por defeitos no material genético, o que permitirá sua prevenção e seu tratamento.

20. (UPE)

Leia o texto a seguir referente às aplicações das técnicas moleculares da genética.

Marcadores moleculares podem ser utilizados com grande eficiência para identificar e inibir a comercialização ilegal de produtos. Existem kits de identificação de diferentes espécies baseados na análise de polimorfismos de DNA de genes mitocondriais e nucleares. A vantagem desses é que podem ser obtidos a partir de material processado e industrializado, que não permitiria a identificação de outra maneira. Assim, é possível identificar com sucesso camarão descascado e congelado, salgado e seco ao sol (como o do acarajé) e em lata. Outro exemplo seria o de peixes brasileiros, como o mero (Epinephelus itajara), cuja carne é frequentemente vendida como se fosse garoupa (Epinephelus marginatus), devido a sua semelhança. Isso torna possível que órgãos de fiscalização ambiental identifiquem, facilmente e sem ambiguidade, o material apreendido.

Fonte: Adaptado de Galetti Jr. Et al., 2008. Genética da conservação na biodiversidade brasileira, pp.119-229. In: fundamentos de Genética da Conservação. Frankham, R., Ballou, J. D., Briscoe, D. A., Ribeirão Preto, SP, editora SBG, 280p.

Essa identificação de espécies é possível, pois:

a) A sequência que contém o sítio de restrição não variável é amplificada, o produto é incubado com uma enzima de restrição qualquer e posteriormente testado em gel, para verificar se houve o corte.

b) É possível caracterizar moléculas de DNA por meio do padrão eletroforético de fragmentos gerados pela digestão com enzimas de restrição, produzindo uma impressão molecular única para todos os indivíduos de uma espécie.

c) Os polimorfismos de DNA podem ser analisados pela digestão de amostras de DNA genômico com a enzima de restrição relevante e pela identificação de fragmentos de restrição específicos, cujos tamanhos representam alelos.

d) Polimorfismos de DNA se constituem em um conjunto de marcadores numerosos e distribuídos por todo o genoma, permitindo a construção de mapas físicos, por enzimas de restrição, embora sua localização genética não possa ser determinada.

e) Um pequeno número de sequências de reconhecimento para enzimas de restrição é conhecido, porém muitos polimorfismos de mutação de DNA serão caracterizados pelos alelos que possuem.

gab

 

Publicado por: Djalma Santos | 19 de outubro de 2015

TESTES DE MITOSE (5/5)

01. (FEI) No processo de mitose:

a) A partir de uma célula diploide originam-se duas novas células diploides.

b) A partir de uma célula diploide originam-se quatro novas células diploides.

c) A partir de uma célula haploide originam-se duas novas células diploides.

d) A partir de uma célula haploide originam-se quatro novas células diploides.

e) A partir de uma célula diploide originam-se quatro novas células haploides.

02. (FaZU) Entre as frases abaixo em relação à divisão celular por mitose, uma é incorreta. Aponte-a:

a) Na metáfase, todos os cromossomos, cada um com duas cromátides, encontram-se no equador da célula em maior grau de condensação.

b) A célula mãe dá origem a duas células filhas com metade do número de cromossomos.

c) As células filhas são idênticas às células mãe.

d) Ocorre nas células somáticas tanto de animais como de vegetais.

e) É um processo muito importante para o crescimento dos organismos.

03. (UNITAU) Nas células somáticas da espécie humana, a separação dos centrômeros e os fenômenos de duplicação do DNA ocorrem na:

a) Interfase e anáfase.

b) Prófase e anáfase.

c) Metáfase e telófase.

d) Interfase e telófase.

e) Metáfase e prófase.

04. (UEL) Analise o gráfico a seguir:

04

O momento em que a célula-mãe acabou de se dividir e cada célula-filha tem um conjunto de cromossomos idêntico ao da original é:

a) 1.

b) 2.

c) 3.

d) 4.

e) 5.

05. (COVEST) Considere as seguintes fases de uma célula em divisão.

05

A sequência correta de eventos na mitose é:

a) 4, 1, 2, 5 e 3.

b) 3, 4, 1, 2 e 5.

c) 4, 3, 2, 1 e 5.

d) 1, 2, 4, 3 e 5.

e) 1, 2, 3, 4 e 5.

06. (UNISA-SP) Quando se inicia a mitose, os cromossomos começam a se condensar:

a) Já estando duplicados desde a interfase precedente, sendo que o máximo de condensação é observado na metáfase.

b) Duplicam-se durante a metáfase, separando-se na anáfase.

c) A condensação máxima é na telófase.

d) A condensação termina na metáfase, ocorrendo a duplicação dos mesmos na anáfase.

e) Duplicam-se na interfase, apresentando um máximo de condensação no período G.

07. O gráfico mostra a variação da quantidade de DNA de uma célula somática durante as diversas fases de sua vida.

07

No gráfico, a mitose propriamente dita e a interfase correspondem, respectivamente, aos intervalos de tempo:

a) 4 a 6 e 1 a 4.

b) 2 a 4 e 3 a 5.

c) 3 a 5 e 1 a 3.

d) 1 a 3 e 4 a 6.

e) 2 a 5 e 3 a 5.

08. (UNIFOR) Considere as fases do ciclo celular e os eventos a seguir:

I. Interfase

II. Anáfase mitótica

III. Metáfase mitótica

a. Duplicação do DNA

b. Disposição dos cromossomos na região mediana da célula

c. Separação das cromátides-irmãs que migram para polos opostos

A alternativa que associa corretamente essas fases com esses eventos é:

a) I-a ; II-b ; III-c.

b) I-a ; II-c ; III-b.

c) I-b ; II-a ; III-c.

d) I-b ; II-c ; III-a.

e) I-c ; II-b ; III-a.

09. (UNIRIO)

1. Telófase

2. Prófase

3. Metáfase

4. Interfase

(   ) Cromossomos na placa equatorial

(   ) Formação do fuso mitótico

(   ) Desaparecimento da membrana nuclear

(   ) Duplicação do DNA

(   ) Citocinese

A associação correta, de cima para baixo, entre as fases da mitose e os fenômenos que nelas ocorrem é:

a) 3, 1, 2, 4, 4.

b) 1, 2, 4, 3, 3.

c) 3, 2, 2, 4, 1.

d) 4, 4, 3, 2, 1.

e) 1, 3, 2, 1, 2.

10. (FUVEST) Mitose é o processo de divisão celular por meio do qual uma célula eucarionte origina, em sequência ordenada de etapas, duas células filhas geneticamente idênticas. Sobre tal processo foram feitas as seguintes afirmações.

I. Na interfase, os cromossomos se duplicam.

II. Na telófase, os cromossomos atingem o máximo de condensação.

III. Na prófase, cada cromossomo e constituído por dois filamentos unidos pelo centrômero.

IV. Na metáfase, ocorre o aparecimento do nucléolo e desespiralização dos cromossomos.

Está correto apenas o que se afirma em:

a) I e II.

b) I e III.

c) I e IV.

d) II e III.

e) II e IV.

11. (UDESC) Assinale a alternativa incorreta.

a) Durante o ciclo celular, ocorre duplicação de cromossomos e sua distribuição para as células-filhas.

b) Os cromossomos são formados por filamentos de DNA e proteínas.

c) Os cromossomos derivam de porções da cromatina que se condensaram formando partículas de forma e número bem definidos para cada espécie.

d) Mitose é o processo pelo qual as células dos seres eucariontes distribuem, em partes iguais, o DNA que foi duplicado durante a interfase para as duas porções do citoplasma que se dividiu.

e) A mitose é realizada por meio de duas divisões sucessivas.

12. (UFRGS) No esquema exposto está apresentada uma célula em anáfase da mitose. Observando-a, pode-se concluir que pertence a um organismo cujas células somáticas e gametas possuem, respectivamente:

12

a) 12 e 6 cromossomos.

b) 6 e 12 cromossomos.

c) 6 e 3 cromossomos.

d) 3 e 6 cromossomos.

e) 24 e 12 cromossomos.

13. (FEI-SP) Se a quantidade de DNA de uma célula somática em divisão é 2X, as células do mesmo tecido, nas fases G1 e G2, apresentam, respectivamente, as seguintes quantidades de DNA:

a) X e X.

b) X/2 e X.

c) X/2 e 2X.

d) X e X/2.

e) X e 2X.

14. (UFRGS) Observe o diagrama, apresentado, que representa o ciclo de vida de uma célula somática humana.

14

Em relação a esse ciclo, é correto afirmar que existem:

a) 23 moléculas de DNA em G1.

b) 23 moléculas de DNA em S.

c) 92 moléculas de DNA em G2.

d) 46 moléculas de DNA na prófase de mitose.

e) 23 moléculas de DNA na telófase de mitose.

15. (UEL) A figura abaixo representa cromossomos em uma célula somática que está sofrendo divisão celular. Com base nessa informação, assinale a alternativa que contém o número correto de moléculas de DNA, cromátides e cromossomos presentes nesta célula.

15a

15b

16. (UNIMONTES) A vincristina é uma droga usada no tratamento do câncer. Comprovadamente, ela inibe a completa formação da tubulina gerando, consequentemente, a dissolução dos microtubulos e inibição da formação do fuso mitótico. Com base nas informações disponibilizadas e nos conhecimentos associados, é correto afirmar que:

a) A droga bloqueará a mitose na prófase.

b) A mitose será interrompida na metáfase.

c) A mitose não ocorrerá, já que a interfase será bloqueada pela ação da droga.

d) A eficiência da droga é atestada pelo bloqueio da interfase.

17. (UEM) Acerca do significado da mitose para os seres vivos, assinale o que for correto.

01. Quando uma alga unicelular, uma ameba ou um paramécio se dividem por mitose, estão originando dois novos indivíduos. Para esses organismos formados por uma única célula, divisão celular significa reprodução.

02. Todos os organismos pluricelulares têm a mitose ocorrendo não apenas para o desenvolvimento, crescimento, renovação e regeneração, mas também para a reprodução.

04. No fim da telófase, em células animais e de alguns protozoários, tem início um processo de estrangulamento na região mediana que termina por dividir a célula. Por começar na periferia e avançar para o centro da célula, esse tipo de divisão citoplasmática é chamado de citocinese centrífuga.

08. Como a célula animal tem centríolo e forma áster, sua mitose é astral. A mitose da célula vegetal é anastral.

16. A mitose pode ocorrer com células de qualquer ploidia, n, 2n, 3n, etc. Todas originam células-filhas com o mesmo número de cromossomos da célula-mãe.

Soma das alternativas corretas:

18. (UEA) A figura traz cromossomos humanos fotografados em células durante o processo de divisão celular.

18

O cromossomo indicado na figura é formado por:

a) Duas fitas duplas de DNA condensadas na interfase.

b) Duas fitas simples de DNA condensadas na interfase.

c) Uma fita dupla de DNA condensada na prófase.

d) Duas fitas duplas de DNA condensadas na prófase.

e) Duas fitas simples de DNA condensadas na prófase.

19. (UEPG) A respeito da mitose, um dos processos fundamentais da divisão celular, em que uma célula se divide, originando duas células-filhas exatamente iguais à célula inicial no que toca à qualidade e à quantidade de material genético, assinale o que for correto.

01. Quando se estuda a mitose em células vegetais, percebem-se diferenças em relação ao processo que ocorre nas células animais. Inicialmente, não há centríolos nem ásteres; mesmo assim, ocorre a formação das fibras do fuso.

02. A mitose é um processo contínuo de divisão celular em que ocorre uma duplicação cromossômica para cada divisão celular. Assim, o número e a qualidade dos cromossomos da célula-mãe são mantidos nas células-filhas. A mitose se divide nas seguintes fases ou etapas: prófase, metáfase, anáfase e telófase.

04. A mitose permite que os organismos pluricelulares cresçam, por meio do aumento do número de células, e substituam células mortas. Assim, as células da nossa pele, de um embrião em desenvolvimento e das pontas das raízes e caules estão em constante mitose.

08. A divisão do citoplasma da célula vegetal não se processa por estrangulamento, como na célula animal. Em vez disso, aparece no equador da célula um esboço de parede, a lamela média, constituída por um polissacarídeo, a pectina. Mais tarde, formam-se duas membranas celulósicas, de um lado e do outro da lamela média.

Soma das alternativas corretas:

20. (UNIFESP) Analise a figura.

20

A figura representa um cromossomo em metáfase mitótica. Portanto, os números I e II correspondem a:

a) Cromossomos emparelhados na meiose, cada um com uma molécula diferente de DNA.

b) Cromátides não irmãs, cada uma com uma molécula idêntica de DNA.

c) Cromátides irmãs, cada uma com duas moléculas diferentes de DNA.

d) Cromátides irmãs, com duas moléculas idênticas de DNA.

e) Cromossomos duplicados, com duas moléculas diferentes de DNA.gab 

Publicado por: Djalma Santos | 19 de outubro de 2015

TESTES DE BIOELETROGÊNESE (2/3)

01. (UNIRIO) Quando um neurônio não está sendo estimulado, encontrando-se em repouso, temos em seu interior uma concentração maior de:

a) K+.

b) Ca++.

c) Na+.

d) Li+.

e) Cl.

02. Assinale a(s) alternativa(s) correta(s).

I   II

0  0 – Os tecidos em geral não obedecem à lei do tudo ou nada.

1  1 – No período refratário absoluto, a célula é incapaz de responder a um novo estímulo.

2  2 – No período refratário relativo, a célula é incapaz de responder a um estímulo.

3  3 – A partir da redistribuição iônica, a célula readquire o PMR.

4  4 – No potencial de ação da membrana, a célula está respondendo ao estímulo fornecido.

03. (UFJF)O processo elétrico que ocorre na transmissão do impulso nervoso:

a) Depende da despolarização da membrana plasmática e termina com a liberação do neurotransmissor na corrente sanguínea.
b) Depende do disparo de potenciais de ação e termina com a liberação de neurotransmissores pelos dendritos.
c) Ocorre sempre no sentido dendrito para o terminal axônico e depende do transporte de íons através da membrana plasmática.
d) Envolve a participação de diferentes tipos de permeases e depende principalmente da interação entre moléculas de actina e miosina.
e) É lento e termina com a liberação do neurotransmissor no citoplasma da célula adjacente.

04. (COVEST) O impulso nervoso é um fenômeno de natureza eletroquímica, autopropagado, que caminha pela membrana do neurônio. Com relação a esse assunto, podemos afirmar que:

I  II

0  0 – Ao ser estimulada, a membrana de um neurônio em repouso se “despolariza”. Na área estimulada, ocorre uma alteração momentânea na permeabilidade da membrana plasmática e a entrada de íons sódio.

1  1 – Ao período de despolarização, segue-se um período de repolarização,  em que o potássio se difunde para o meio extracelular. Posteriormente, a bomba de sódio e potássio restabelece os gradientes normais desses íons na célula.

2  2 – Se o estímulo for de baixa intensidade, inferior ao limiar de excitação, as alterações sofridas pelo neurônio serão suficientes apenas para gerar um impulso nervoso de baixa propagação.

3  3 – A membrana do neurônio em repouso é polarizada como uma pilha elétrica. Sua face interna representa o polo negativo, e a face externa funciona como polo positivo.

4 4 – Axônios amielínicos transmitem o impulso nervoso mais rapidamente que os mielinizados.

05. Assinale a(s) alternativa(s) correta(s).

I   II

0  0 – O limiar de excitação é igual para todas as células.

1  1 – A excitabilidade á variável numa mesma célula.

2  2 – A excitabilidade é variável nos diversos tipos celulares.

3  3 – A excitabilidade é constante para toda célula.

4  4 – A célula óssea, por exemplo, apresenta um baixo limiar de excitação.

06. Analise o esquema abaixo, que representa uma “parte” de um axônio em repouso, e assinale a(s) alternativa(s) correta(s).

06

I   II

0  0 – A ocorrência do impulso nervoso depende apenas de estímulos de natureza física.

1  1 – As concentrações dos íons Na+ e K+ diferenciadas são mantidas sem gasto de energia, sendo exemplo de transporte passivo.

2  2 – Se a membrana do neurônio for atingida por um estímulo, as quantidades de Na+ e K+, dentro e fora da membrana se igualam.

3  3 – A quantidade de íons K+ é menor na parte interna do neurônio devido a sua saída por difusão.

4 4 – Devido à diferença de cargas entre as faces externa e interna, o neurônio está polarizado.

07. Assinale a(s) alternativas correta(s):

I  II

0  0 – A redistribuição iônica independe das bombas de Na+ e K+.

1 1 – No período refratário relativo, que ocorre durante a inversão da polaridade, a célula é capaz de responde a um estímulo.

2 2 – A ocorrência do PMR (potencial de repouso da membrana) se deve à distribuição de íons nos meios intra e extracelular.

3 3 – O influxo de K+, em grande quantidade, determina a inversão da polaridade, que caracteriza o potencial de ação da membrana (PAM).

4  4 – Podemos relacionar a lei do tudo ou nada com irritabilidade e resposta.

08. Assinale a(s) alternativa(s) correta(s):

I  II

0  0 – Considerando-se  uma  fibra  nervosa,  um  estímulo  maximal   induzirá, certamente, uma resposta mais intensa que um estímulo minimal.

1 1 – O estímulo é capaz de transformar a condição celular que existe em potencial (excitabilidade) em condição ou estado dinâmico (excitação).

2  2 – No potencial de repouso a célula é inexcitável.

3  3 – O impulso nervoso é uma onda de modificações bioeletroquímicas.

4  4 – Quando em “repouso” a  célula apresenta  uma  eletronegatividade externa.

09. Assinale a(s) alternativa(s) correta(s):

I   II

0  0 – Na célula em “repouso” ocorre uma saída constante de sódio.

1  1 – Apenas as fibras nervosas obedecem à lei do tudo ou nada.

2  2 –  O potencial de repouso é  um fenômeno  exclusivo das  células musculares e nervosas.

3  3 – Os  estímulos subminimais,  mesmo  repetidos,  mostram-se  incapazes  de induzir uma resposta aparente.

4  4 – Em um  determinado neurônio,  o impulso elétrico  se propaga com a mesma intensidade, qualquer que seja a intensidade do estímulo acima do limiar mínimo.

10. No século XIX, Hermann von Helmholtz realizou um experimento usando o seguinte dispositivo.

10

Uma preparação de músculo de rã com o nervo ainda conectado a este foi montada, de forma que uma das extremidades do músculo ficasse presa a um suporte fixo e a outra a uma alavanca com uma “agulha” que tocava num tambor giratório de velocidade constante e conhecida. A “agulha” poderia assim registrar o movimento do músculo. Num primeiro momento, o nervo do músculo foi estimulado eletricamente na posição S1. O movimento da contração muscular foi então registrado no tambor giratório, gerando a curva 1. Em seguida, o nervo foi estimulado com a mesma intensidade na posição S2, sendo este estímulo aplicado no momento em que a “agulha” coincidia com o início da curva 1. Este segundo estímulo gerou a curva 2. Qual a característica do impulso nervoso que foi, teoricamente, medida nesse experimento?

a) A velocidade da repolarização.

b) A ação das bombas de sódio e potássio.

c) A velocidade de fechamento dos canais de potássio.

d) A velocidade de propagação do impulso nervoso ao longo da fibra nervosa.

e) O valor do potencial de ação.

11. (FAVIP) Aplicado um estímulo num ponto de um axônio, como ilustrado na figura, ocorrem os seguintes eventos:

11

1. A membrana torna-se muito permeável ao sódio (X), que passa do meio para o interior do axônio em maior quantidade do que os íons potássio (Y) saem do interior para o meio.

2. A membrana torna-se muito permeável ao potássio (X), que passa do meio para o interior do axônio em maior quantidade do que os íons sódio (Y) saem do interior para o meio.

3. A superfície da membrana, no ponto e no instante do estímulo, fica externamente negativa e internamente positiva; diz-se, então, que a membrana sofreu inversão de polaridade.

4. Os íons sódio (X) são expulsos, e a membrana volta à polaridade inicial.

Estão corretas apenas:

a) 1 e 4.

b) 2 e 3.

c) 1, 3 e 4.

d) 2, 3 e 4.

e) 1 e 3.

12. São estruturas que não obedecem à Lei do Tudo ou Nada.

I  II

0  0 – Células isoladas.

1  1 –  Músculo estriado cardíaco (miocárdio).

2  2 –  Músculo estriado esquelético.

3  3 –  As glândulas em geral.

4  4 – Célula muscular esquelética.

13. (UFAM) A figura a seguir representa um momento elétrico na vida de uma célula em uma junção muito especial chamada de placa motora. Se (A) representa o corpo celular de um neurônio-motor, (C) seu axônio e (B) o músculo gastrocnêmico, qual das seguintes afirmativas explica corretamente os fenômenos 1 e 2 que ocorrem na fibra muscular:

13

a) 1 indica a “despolarização” da membrana provocada pela abertura dos canais de Na+, enquanto que 2 indica a abertura dos canais de K+ e início da repolarização da membrana.

b) 1 indica a repolarização da membrana provocada pela abertura dos canais de Na+, enquanto que 2 indica a abertura dos canais de K+ e início da “despolarização” da membrana.

c) 1 indica a “despolarização” da membrana provocada pela abertura dos canais de K+, enquanto que 2 indica a abertura dos canais de Na+ e início da repolarização da membrana.

d) 1 indica a hiperpolarização da membrana provocada pela abertura dos canais de Na+, enquanto que 2 indica a abertura dos canais de K+ e início da “despolarização” da membrana.

e) 1 indica a “despolarização” da membrana provocada pelo fechamento dos canais de Na+, enquanto que 2 indica o fechamento dos canais de K+ e início da repolarização da membrana.

14. (FUVEST) Na telefonia celular, a voz é transformada em sinais elétricos que caminham como ondas de rádio. Como a onda viaja pelo ar, o fio não é necessário. O celular recebe esse nome porque as regiões atendidas pelo serviço foram divididas em áreas chamadas células. Cada célula capta a mensagem e a transfere diretamente para uma central de controle.

http://www.física.cdcc.usp.br.Acessadoem22/07/2013.Adaptado.

No que se refere à transmissão da informação no sistema nervoso, uma analogia entre a telefonia celular e o que ocorre no corpo humano:

a) É completamente válida, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais elétricos transmitidos por uma célula, sem intermediários, a uma central de controle.

b) É válida apenas em parte, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais elétricos que resultam em resposta imediata, sem atingir uma central de controle.

c) É válida apenas em parte, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais elétricos transferidos, célula a célula, até uma central de controle.

d) Não é válida, pois, no corpo humano, as informações do meio são captadas e transformadas em estímulos hormonais, transmitidos rapidamente a uma central de controle.

e) Não é válida, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais químicos e elétricos, transferidos a vários pontos periféricos de controle.

15. (UEM) Acerca da propagação do impulso nervoso, assinale o que for correto.

I   II

0  0 – A “despolarização” de uma área da membrana causa alteração de permeabilidade da área vizinha à sua frente.

1  1 – O impulso nervoso nada mais é do que a propagação do potencial de ação ao longo do neurônio.

2  2 – O impulso nervoso é bidirecional em uma neurofibra.

3  3 – Nos dendritos, o impulso nervoso se propaga das extremidades dendríticas para o corpo celular, sendo chamado de celulípeto. No axônio, o impulso nervoso se propaga de sua junção com o corpo celular para a extremidade axônica, sendo chamado de celulífugo.

4  4 – Os estímulos são captados pelos dendritos ou pelo próprio corpo celular. Algumas vezes, até mesmo pelo axônio.

16. (IFNMG) A figura abaixo ilustra o mecanismo fisiológico de comunicação entre neurônios.

16

Fonte: http://www2.dq.fct.unl.pt/cadeiras/qpn1/proj/acetilcolina/sinapses.htm.

Acesso em: 22 out. 2014.

Em relação à sinapse axodendrítica evidenciada, pode-se afirmar que:

a) A membrana pós-sináptica sofrerá uma repolarização para desencadear um novo impulso nervoso.

b) Na fenda sináptica são liberados os neurotransmissores a partir de uma exocitose das vesículas sinápticas.

c) O impulso nervoso é bidirecional, podendo passar do axônio para o dendrito assim como do dendrito para o axônio.

d) O potencial de repouso gerado pela “despolarização” da membrana pré-sináptica é de + 40Mv.

17. (UFSC) Sobre biofísica de membranas, assinale a alternativa correta.

a) O influxo de sódio na célula é responsável pela fase de “despolarização” do potencial de ação de um neurônio.

b) Um neurotransmissor tem como ação imediata na membrana pós-sináptica um potencial de ação.

c) Os potenciais graduáveis são reservados às membranas das células musculares.

d) Na grande maioria das células, o potencial de repouso da membrana celular tem um valor mais próximo do potencial de equilíbrio eletroquímico do íon potássio e mais distante do potencial de equilíbrio eletroquímico do íon sódio.

e) A bomba de sódio/potássio compensa o excesso de sódio que entra nas células e o excesso de potássio que sai das células, transferindo esses íons através da membrana a favor de seus gradientes de concentração.

18. (FMJ) O gráfico mostra a formação de um potencial de ação em um neurônio.

18

Após aplicar um estímulo na célula nervosa, ocorre uma fase de “despolarização” e, em seguida, ocorre a fase de repolarização, retornando ao estado de “repouso”. A alteração de polaridade é conhecida como potencial de ação, que permite a propagação do impulso nervoso. Assim, de acordo com o gráfico, após ocorrer o estímulo, a despolarização consiste na:

a) Saída de íons sódio por transporte passivo.

b) Entrada de íons potássio por transporte ativo.

c) Saída de íons cloro por difusão.

d) Saída de íons potássio por transporte ativo.

e) Entrada de íons sódio por difusão.

19. Assinale a(s) alternativa(s) correta(s).

I   II

0   0 – Tomando como exemplo o axônio da fibra nervosa em repouso, é correto afirmar que os cátions mais abundantes fora e dentro da célula são, respectivamente, K+ e Na+.

1  1 – Excitabilidade é a capacidade da célula viva de responder às variações de energia (estímulos).

2  2 – Modificações elétricas e químicas que vão se propagando ao longo de uma fibra nervosa são conhecidas, genericamente, como polarização.

3  3 – O aumento da concentração extracelular de K+ e Na+ diminui a excitabilidade.

4 4 – A diminuição da concentração de Ca++ e Mg++ extracelular diminui o limiar de excitação.

20. (COVEST) Analise a figura abaixo, que mostra a variação do potencial da membrana durante a resposta “tudo ou nada” do neurônio a um estímulo eficaz.

20

I  II

0  0 – Na fase 1, a membrana celular apresenta uma maior permeabilidade ao K+, tornando o meio intracelular mais negativo em relação ao meio extracelular.

1  1 – Na fase 2, a célula apresenta uma inversão de sua polaridade, sendo o interior da célula positivo em relação ao meio extracelular.

2 2 – A fase 3 corresponde ao momento de repolarização do neurônio, sendo este incapaz de responder a outro estímulo; por isso, esse momento é chamado de período refratário absoluto.

3  3 – Na fase 4, ocorre a redistribuição de íons através da membrana, sendo que, ativamente, o sódio é retirado e, ao mesmo tempo, ocorre entrada de potássio.

4  4 – Na fase 5, a célula alcançou seu nível de repouso; nessa fase, é mais difícil obter-se uma resposta a qualquer estímulo.

gab

 

 

 

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE CITOLOGIA (3)

01. (IFSC) Durante uma aula de laboratório foram colocadas em frente a um aluno três fotografias de células. As fotografias foram obtidas por microscópio eletrônico de transmissão e havia uma lista de algumas estruturas identificadas para cada célula:

Célula 1: parede celular, mitocôndrias, plasmodesmas e vacúolo de suco celular ou central.

Célula 2: mesossoma, plasmídeo, parede celular e ribossomos.

Célula 3: glicocálix, mitocôndrias, ribossomos e lisossomos.

Considerando seus conhecimentos sobre biologia celular, assinale a soma da(s) proposição(ões) correta(s).

01. O plasmídeo corresponde a uma molécula circular de DNA existente em células procariontes, sendo assim o organismo representado pela célula 2 pertence a um organismo do reino Monera, que inclui, as bactérias e cianobactérias.

02. A presença de parede celular nas células 1 e 2 indica que as duas células pertencem a organismos vegetais.

04. Se considerarmos que o organismo representado pela célula 3 é multicelular e não apresenta parede celular, poderemos afirmar que se trata de um animal.

08. Todas as três células possuem ácidos nucleicos e sintetizam proteínas através dos processos de transcrição e tradução.

16. Se considerarmos que as mitocôndrias não existem na célula 2, poderemos então afirmar que esse organismo é fotossintetizante.

Soma das alternativas corretas:

02. (IFMG) Observando as células da epiderme humana, uma bactéria e a célula da epiderme da raiz de uma goiabeira, pode-se afirmar que todas possuem:

a) Membrana plasmática e mitocôndrias, porém só a bactéria possui parede celular.

b) Membrana plasmática e mitocôndrias, porém só a célula da epiderme da raiz de uma goiabeira possui parede celular.

c) DNA, membrana plasmática e ribossomos, porém só a célula da epiderme da raiz de uma goiabeira possui parede celular.

d) DNA, membrana plasmática e ribossomos, porém só a célula da epiderme humana não possui parede celular.

03. (PUC-CAMPINAS) Um estudante, ao comparar o Lêvedo de cerveja com algas verdes unicelulares, apresentou as seguintes conclusões:

I. Ambos são organismos autótrofos.

II. As células de ambos possuem núcleo com carioteca.

III. Em ambos ocorre o processo da glicólise.

IV. As células de ambos são circundadas por parede celular com a mesma constituição química.

O estudante acertou apenas nas conclusões:

a) I e II.

b) I e III.

c) I e IV.

d) II e III.

e) III e IV.

04. (UNEB) Bastante consumida no Brasil, a linguiça frescal está no barzinho da esquina e na mesa dos brasileiros. Mas a qualidade do produto varia de região para região, devido aos diferentes métodos de processamento empregados, principalmente se for preparado de modo artesanal, linguiça caseira. Nesta, os sais de cura, compostos adicionados a carnes com finalidade bactericida e também para dar-lhes cor e sabor atraentes, não conseguem controlar, mesmo sob refrigeração, a bactéria patogênica Staphylococcus aureus, comum em contaminações nesse tipo de alimento. Os níveis de sal de cura usados em linguiças, como o nitrito e o nitrato de sódio, são insuficientes para combater S. aureus. Mas, como ainda não se tem espécies químicas com ação bactericida igual ou superior à do nitrito, nesse tipo de produto para combater essa e outras bactérias, como a Salmonella, a espécie química ainda é empregada. A higiene passa a ser então, segundo o pesquisador, um item essencial para evitar que a linguiça caseira seja contaminada durante o processo de produção.

A ‘cura de carnes’ é um procedimento cujo fim é conservar a carne por um tempo maior a partir da adição de sais, açúcar, condimentos e compostos que fixam a cor, conferem aroma agradável e evitam contaminação. Entre esses, estão os nitratos e nitritos, que dão cor avermelhada ao alimento e funcionam como agente bacteriostático.

(PERIGO oculto, 2009, p. 60-61).

A respeito da organização celular característica dos organismos citados no texto, é correto afirmar:

01. Apresentam envoltório interno delimitando o material genético em um núcleo diferenciado.

02. Realizam síntese proteica exclusivamente em polissomos livres espalhados no citoplasma celular.

03. São seres anaeróbios obrigatórios devido à ausência de organelas do tipo mitocôndrias em seu ambiente citossólico celular.

04. Possuem maior virulência por causa da sua resistência a baixas temperaturas devido à presença de intensa área com retículos endoplasmáticos.

05. Os sais de cura são eficientes no controle bacteriano por interferir na síntese de esteroides nas cisternas do complexo golgiense bacteriano.

Soma das alternativas corretas:

05. Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas droga antimitóticas que inibem na progressão a partir dos pontos indicados.

05

Assinale a afirmativa incorreta.

a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular.

b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular.

c) Pelo menos duas das drogas interferem diretamente na síntese proteica.

d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo.

06. O caráter procariótico do sistema genético das mitocôndrias, bem como dos cloroplastos, sugere que essas organelas Originaram-se de bactérias endocitadas há mais de um bilhão de anos. De fato, evidencia-se uma grande semelhança entre o funcionamento e constituição dessas organelas e bactérias. São evidências da hipótese endossimbiôntica descrita acima, exceto:

a) Síntese proteica por ribossomos próprios das organelas.

b) Mitocôndrias e cloroplastos apresentam DNA e RNA.

c) Presença de duas membranas lipoproteicas nas organelas.

d) Sobrevivência autônoma das organelas isoladas da célula.

07. Os protozoários são organismos que em sua maioria habitam o ambiente aquático, entretanto, não apresentam parede celular. Eles apresentam como mecanismo para eliminar o excesso de água absorvido, em ambiente dulcícola, uma estrutura que permite a osmorregulação. Essa estrutura é conhecida como:

a) Vacúolos contráteis.

b) Pseudópodes

c) Membrana Plasmática

d) Flagelos

e) Cílios

08. (UFSC)

08

Fonte: AMABIS, JM e MARTHO, G. Biologia das Células. 1a ed.

São Paulo: Moderna, 2004, p. 130-132.

Em relação aos desenhos acima, é correto afirmar que:

01. O desenho A representa uma célula animal, o desenho B representa uma célula vegetal e o desenho C representa uma bactéria.

02. A seta 1 indica o local de produção de ATP; a seta 2 indica a organela responsável pela produção de enzimas digestivas e a seta 3 indica elementos responsáveis pela síntese de polipeptídeos.

04. A seta 4 indica o local de produção de proteínas, que poderão ser transportadas para o local indicado pela seta 5, estrutura responsável por liberar as proteínas no meio extracelular.

08. Apesar de sua diversidade, todas as células apresentam membrana plasmática, citoplasma, núcleo e carioteca.

16. Os ribossomos são elementos complexos que aparecem somente nas células eucariotas.

32. A membrana plasmática da célula animal é frágil e flexível, ao passo que a membrana plasmática da célula vegetal é espessa e rígida, devido à celulose.

64. A clorofila é um pigmento apresentado apenas por células vegetais.

Soma das alternativas corretas:

09. (UFTM) Os eritroblastos são células que apresentam núcleo e várias organelas membranosas. Durante a diferenciação celular, formam-se os eritrócitos (hemácias), que são anucleados e não possuem organelas. Ao longo desse processo, o núcleo é:

a) Eliminado por endocitose e os lisossomos realizam a heterofagia das organelas celulares, eliminando-as da célula.

b) Eliminado por clasmocitose e os peroxissomos realizam a autofagia, autodestruindo as organelas celulares.

c) Eliminado por exocitose e os lisossomos realizam a autofagia, processo que leva à destruição das organelas.

d) Destruído no interior da célula, juntamente com várias organelas, pelas enzimas contidas nos lisossomos.

e) Destruído no interior da célula pelas enzimas dos peroxissomos e as organelas são destruídas pelas enzimas lisossômicas.

10. O uso indiscriminado e incorreto de antibióticos para combater infecções tem contribuído para o “desenvolvimento” de genes mais resistentes a esses medicamentos. Esses genes ficam localizados:

a) No microplasma.

b) Nas enzimas de restrição.

c) Nos plasmídeos.

d) Nos pili.

e) No glicolipídeo.

11. (MACK) O esquema abaixo representa uma das teorias para a evolução celular. A esse respeito são feitas as seguintes afirmações:

11

I. O organismo 1 é semelhante às bactérias atuais.

II. A formação de dobras na membrana levou ao surgimento de estruturas como o retículo endoplasmático, o complexo de Golgi e a carioteca.

III. Uma das principais vantagens da ocorrência da formação das dobras na membrana é o aumento de superfície de contato entre o citoplasma e o meio.

Assinale:

a) Se somente as afirmativas I e III estiverem corretas.

b) Se somente as afirmativas II e III estiverem corretas.

c) Se todas as afirmativas estiverem corretas.

d) Se somente a afirmativa III estiver correta.

e) Se somente as afirmativas I e II estiverem corretas.

12. (UEL) Na década de 1950, a pesquisa biológica começou a empregar os microscópios eletrônicos, que possibilitaram o estudo detalhado da estrutura interna das células. Observe, na figura a seguir, a ilustração de uma célula vegetal e algumas imagens em micrografia eletrônica.

12

(Adaptado de: SADAVA, D. et all. Vida: A ciência da biologia. V. 1. 8 ed. Porto Alegre: Artmed. 2009. p. 77.)

Quanto às estruturas anteriormente relacionadas, é correto afirmar:

a) A imagem 1 é de uma organela onde as substâncias obtidas do ambiente externo são processadas, fornecendo energia para o metabolismo celular.

b) A imagem 2 é de uma organela na qual a energia da luz é convertida na energia química presente em ligações entre átomos, produzindo açúcares.

c) A imagem 3 é de uma organela que concentra, empacota e seleciona as proteínas antes de enviá-las para suas destinações celulares ou extracelulares.

d) A imagem 4 é de uma organela na qual a energia química potencial de moléculas combustíveis é convertida em uma forma de energia passível de uso pela célula.

e) A imagem 5 é de uma organela que produz diversos tipos de enzimas capazes de digerir grande variedade de substâncias orgânicas.

13. (UNESP) A figura apresenta os esquemas de duas células.

13

Porém, o ilustrador cometeu um engano ao identificar as estruturas celulares. É correto afirmar que:

a) II é uma célula vegetal e o engano está na identificação do complexo golgiense nesta célula, uma vez que este ocorre em células animais, mas não em células vegetais.

b) II é uma célula animal e o engano está na identificação do vacúolo em ambas as células, além de este ser característico de células vegetais, mas não de células animais.

c) II é uma célula animal e o engano está na identificação dos centríolos nesta célula, uma vez que estes são característicos de células vegetais, mas não de células animais.

d) I é uma célula animal e o engano está na identificação das mitocôndrias em ambas as células, além de estas ocorrerem em células animais, mas não em células vegetais.

e) I é uma célula vegetal e o engano está na identificação da membrana plasmática nesta célula, uma vez que esta ocorre em células animais, mas não em células vegetais.

14. (UNIFOR) Considere as seguintes afirmações sobre essa figura:

14

I. Representa uma célula bacteriana devido à presença de parede celular e plasmodesmos.

II. Mostra uma célula animal uma vez que possui complexo de Golgi, retículo endoplasmático e mitocôndrias.

III. Esquematiza uma célula vegetal já que apresenta parede celular, plasmodesmos, cloroplastos e vacúolos.

É compatível com a figura o que se afirma somente em:

a) I.

b) II.

c) III.

d) I e II.

e) I e III.

15. (PUC-RS) Em um experimento com ratos de laboratório, um biólogo constatou que o aumento de substâncias tóxicas na circulação induzia os hepatócitos a intensificarem a fabricação, empacotamento e exocitose de enzimas desintoxicantes a fim de neutralizar a toxicidade no organismo. Tal constatação se deveu a uma observação citológica dos referidos hepatócitos, nos quais foi possível detectar:

a) O aumento da área do retículo endoplasmático.

b) O aumento na divisão mitocondrial.

c) A diminuição do número de organelas.

d) A diminuição da quantidade de ribossomos.

e) A duplicação do nucléolo.

16. (UFU) No metabolismo célula, as mitocôndrias convertem glicose e oxigênio em energia. Como subproduto dessa reação, formam-se radicais de oxigênio (superóxido) que são convertidos, pela enzima superóxido dismutase (SOD), em peróxidos de hidrogênio. Considerando o processo metabólico acima apresentado, analise as afirmativas abaixo.

I. Os radicais de oxigênio são altamente reativos, podendo danificar o DNA dos cromossomos, o DNA mitocondrial e a membrana celular. Assim sendo, a SOD transforma esses radicais em peróxidos de hidrogênio, que é inócuo à célula.

II. O peróxido de hidrogênio é tóxico e mutagênico. Assim sendo, com ajuda da catalase, deve ser convertido em oxigênio molecular e água, que são substâncias inócuas para o meio celular.

III. Peroxissomos são vesículas celulares que contem enzimas que modificam substâncias tóxicas, tornando-se inofensivas para a célula.

Marque a alternativa correta.

a) I e II são corretas.

b) II e II são corretas.

c) I e III são corretas.

d) Apenas I é correta.

17. (COVEST) Na tabela abaixo, é mostrada a distribuição de algumas estruturas celulares em três tipos de células. Considerando essa distribuição, assinale a alternativa correta.

17

18. (UPE)  Leia o texto a seguir:

Várias são as formas de observação cromossômica óptica em gafanhotos, organismos modelo para o estudo de divisão celular, as quais incluem técnicas clássicas e diferenciais. A técnica clássica de esmagamento de folículos associada à coloração convencional permite visualizar a cromatina do núcleo interfásico, bem como o número e a morfologia cromossômica em fases da mitose e/ou meiose. As técnicas diferenciais podem ou não usar ferramentas moleculares e mostram detalhes da organização cromossômica. Uma técnica muito simples, conhecida como impregnação por nitrato de prata, permite visualizar os produtos remanescentes dos nucléolos ativos da interfase anterior.

Sobre a organela mencionada no texto, é correto afirmar que:

a) A aglomeração dinâmica de partículas ribossômicas em formação origina os nucléolos, que são massas densas delimitadas por membranas, ocorrendo sempre aos pares, e visualizadas por microscopia óptica ou eletrônica.

b) Ao ocorrer a espiralação cromossômica, os nucléolos desaparecem rapidamente e voltam a reaparecer no fim da divisão nuclear, portanto a melhor fase da meiose para se observarem nucléolos através da coloração convencional é a anáfase I.

c) Nucléolos são gerados nas regiões teloméricas de alguns cromossomos e podem ser evidenciados de forma direta por meio de coloração convencional, pois as ribonucleoproteínas produzidas não saem do núcleo.

d) Genes para ácido ribonucleico ribossômico (RNAr) são intensamente transcritos nas regiões organizadoras de nucléolos dos cromossomos, e seus produtos podem ser visualizados pelo nitrato de prata.

e) Nucléolos são regiões de intensa produção de ácido ribonucleico transportador (RNAt), principal componente dos ribossomos. Ao término da síntese, esse RNA associa‐se a proteínas originando as ribonucleoproteínas, visualizadas pelo nitrato de prata.

19. (COVEST) Células procariontes e eucariontes possuem tanto aspectos em comum quanto aspectos que as diferenciam. A figura abaixo representa esses tipos celulares indicando alguns de seus componentes. Em relação às características dessas células e aos aspectos indicados na figura, podemos afirmar o que segue.

19

I   II

0  0 – Tanto procariontes quanto eucariontes possuem o mecanismo replicativo/hereditário na forma de ácidos nucleicos.

1  1 – Células procariontes não possuem os ribossomos, que são necessários à produção de proteínas nas células eucariontes.

2  2  – Por possuírem parede celular, as células A e C são certamente procariontes.

3  3 – A célula A não possui material nuclear e, portanto, também não possui os genes, sendo assim uma célula procarionte.

4  4 – A célula A é procarionte, e as células B e C são eucariontes.

20. (FATEC) Considere as características das células A, B, C e D que estão representadas na tabela abaixo, relacionadas à presença (+) ou ausência (–) de alguns componentes.

20

São exemplos de organismos que possuem células do tipo A, B, C e D, respectivamente,

a) Paramécio, pinheiro, cogumelo e cobra.

b) Cianobactéria, fungo, ameba e minhoca.

c) Paramécio, musgo, bolor de pão e gato.

d) Cianobactéria, samambaia, champignon e paramécio.

e) Bactéria, líquen, bolor do mamão e mosquito.

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE GENÉTICA MOLECULAR (5)

01. (UNESP) Na segunda metade do século XIX, Mendel havia descoberto algumas regras básicas sobre herança, mas suas ideias passaram despercebidas. No início dos anos 1900, Walter Sutton e outros verificaram que o comportamento dos cromossomos na divisão celular correspondia ao descrito por Mendel para os fatores hereditários. O que faltava era comprovar a ligação entre esses dados. A descoberta que possibilitou isso foi:

a) As mutações genéticas estão correlacionadas às mudanças evolutivas, por Theodosius Dobzhansky.

b) É possível conhecer a exata localização de um gene no cromossomo, como demonstrado por Calvin Bridges.

c) Os raios X aumentam dramaticamente a taxa de mutações, por Hermann Müller.

d) O DNA tem uma conformação em dupla hélice, por James Watson e Francis Crick.

e) Os genes localizam-se em posições específicas do cromossomo, por Thomas Morgan.

02. (X Olimpíada Brasileira de BIOLOGIA)

O texto abaixo descreve bioquimicamente as diferenças observadas por Mendel quanto à forma da semente. Analise o texto e responda esta questão

• O alelo A que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases que codifica a enzima SBE-1 (starch-branching enzyme ou enzima ramificadora do amido).

• O alelo a que codifica a semente rugosa, é um fragmento de DNA com uma inserção de 800 pares de bases, portanto o gene possui 4,1 mil pares de bases e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, levando a um maior acumulo de água, e quando a semente seca torna-se rugosa.

Supondo que os fragmentos de DNA descritos correspondem a éxons (segmentos ativos) espera-se que as enzimas codificadas pelos genes A e a, contenham, respectivamente, o seguinte número aproximado de aminoácidos:

a) 1.100; 267.

b) 1.100; 4.100.

c) 2.200; 2734.

d) 9.900; 12.300.

e) 1100; 1367.

03. Os seres vivos são farinha do mesmo saco.

Analise as alternativas a seguir e assinale a que melhor justifica a seguinte frase:

a) Todos os seres vivos têm uma composição química semelhante: são feitos da mesma matéria.

b) Há no corpo centenas de trilhões de células controladas pelos DNAs.

c) No DNA está escrito até o jeito dos filhos que você pode vir a ter.

d) A duplicação do DNA significa a duplicação dos cromossomos, conduzindo à duplicação das células.

04. “Radioatividade após acidente de Fukushima causou mutação nas borboletas”

“Mutações genéticas foram detectadas em três gerações de borboletas nos arredores da central nuclear japonesa de Fukushima, informaram cientistas japoneses, o que aumenta os temores de que a radioatividade possa afetar outras espécies.”

                                                                                                                                                                                 Fonte: UOL Notícias Tecnologia.

O texto acima é um fragmento de uma notícia veiculada em agosto deste ano na mídia eletrônica. De acordo com os dados da notícia e seus conhecimentos sobre o assunto, assinale a alternativa correta:

a) Os cientistas japoneses concluíram que se até as borboletas, que são seres pequenos e frágeis, foram afetadas pela radioatividade, com certeza os seres humanos também foram.

b) Em Fukushima, a radioatividade atuou como agente mutagênico para as borboletas dos arredores da central nuclear, causando nelas alterações genéticas.

c) A radioatividade causou mutação nas borboletas da região próxima a Fukushima, pois as borboletas são seres que têm predisposição genética para esse tipo de erro.

d) A mutação, como a ocorrida nas borboletas, nada mais é do que uma diminuição do número de células do organismo.

e) O agente mutagênico, que nesse caso é a radioatividade, é uma substância capaz de multiplicar células normais nos organismos.

05. Sobre os ácidos nucleicos, são feitas as seguintes afirmações:

I. São macromoléculas de elevada massa molecular, que possuem ácido fosfórico, açúcares e bases púricas e pirimídicas em sua composição.

II. Ocorrem em todas as células vivas e são responsáveis pelo armazenamento e transmissão da informação genética e por sua tradução, que é expressa pela síntese proteica.

III. Encontram-se presentes no núcleo dos procariotos e dispersos no hialoplasma dos eucariotos.

IV. Encontram-se normalmente organizados sob a forma de fita simples ou dupla.

Das quatro afirmações anteriores, são verdadeiras:

a) Apenas a III e IV.

b) Apenas a III.

c) Apenas a I, II e IV.

d) Apenas a I e II.

e) Todas as afirmações são corretas.

06. (UNIOESTE) Com relação ao material genético, é correto afirmar que:

01. Cada RNA mensageiro possui, em determinada região de sua molécula, o anticódon.

02. O DNA apresenta, entre suas bases púricas, uracil e o RNA, timina.

04. Entre os cromossomos homólogos ocorre permuta gênica, o que garante a variabilidade genética.

08. As cadeias de RNA mensageiro são produtos da atividade ribossômica.

16. A alteração na seqüência de bases nitrogenadas de um segmento de DNA é uma mutação.

32. O DNA e o RNA, quanto à sua estrutura química, são polipeptídeos.

Soma das alternativas corretas:

07. O esquema abaixo representa um segmento de uma cadeia proteica e os anticódons correspondentes aos aminoácidos.

07

Os códons correspondentes ao cístron são:

a) ACC – CAT – TGA – ATA – GTG.

b) UGG – GUA – ACU – UAU – CAC.

c) TGG – CAT – GTG – ATT – UAU.

d) UGG – CAU – GUG – AUA – CAU.

e) TAT – GTA – ACT – TAT – CAC.

08. Com relação ao DNA, assinale a afirmativa incorreta.

a) As informações hereditárias são codificadas no DNA.

b) Graças à capacidade do DNA de autoduplicar-se, os gens podem manter suas características de uma geração a outra.

c) A molécula de DNA apresenta-se estruturalmente como uma dupla hélice.

d) O DNA é encontrado em grande quantidade no citoplasma e em pequenas quantidades no núcleo.

e) É um polinucleotídeo, sendo cada nucleotídeo formado de desoxirribose, fosfato e base nitrogenada, os quais se unem por meio do fosfato de um nucleotídeo com a pentose do outro.

09. (VUNESP) Um dos filamentos da dupla hélice de uma molécula de DNA tem a seguinte sequência: AACGATCGCTCA. Os seus produtos de duplicação e transcrição são, respectivamente:

a) AACGATCGCTCA; TTGCTAGCGAGT.

b) TTGCTAGCGAGT; UUGCUAGCGAGU.

c) UUCGUACGCACU; TTGCTAGCGAGT.

d) TTGCTAGCGAGT; AACGATCGCTCA.

e) TTCGTACGCACT; AACGATCGCTCA.

10. Com relação ao código genético assinale as afirmações corretas:

01. O código genético é universal, isto é, é o mesmo para todos os seres vivos.

02. Cada trinca de bases do DNA codifica sempre o mesmo aminoácido da cadeia polipeptídica.

04. Cada aminoácido pode ser codificado por mais de uma trinca de bases na cadeia do DNA.

08. O mesmo ribossomo, traduzindo diferentes moléculas de RNAm, dará origem a diferentes tipos de moléculas proteicas.

16. A mesma molécula de RNAm, sendo traduzida por diferentes ribossomos, dará origem a várias moléculas da mesma proteína.

Soma das alternativas corretas:

11. (IFMT) Genes saltadores no DNA humano

O genoma humano é constituído por cerca de 50% de elementos transponíveis DNA, os chamados “genes saltadores”. Alguns desses elementos saltadores saem de um local para se inserir em outro. Outros estão sendo copiados para novos locais, resultando em crescente número de inserções em todo o genoma humano. Seja qual for o mecanismo, todos os elementos transponíveis têm o potencial de afetar a mudança por meio de mutações, duplicações ou supressões. Baseando-se em seus conhecimentos da genética, marque a alternativa que melhor define o termo Genoma.

                                                                                                  (dnaeoutrascoisas.blogspot.com/).

a) Estrutura microscópica constituída pela molécula de DNA.

b) Alelo que só determina o caráter quando ocorre em dose dupla.

c) Aspecto do indivíduo determinado pela expressão das características genéticas.

d) Conjunto dos genes existentes em todos os cromossomas de uma espécie.

e) Segmento do DNA com informações para a síntese de uma proteína.

12. (UEM) Sobre a estrutura e a função dos genes, assinale o que for correto.

01. Os métodos para identificação individual de pessoas pelo DNA, como os testes de paternidade ou de identificação de criminosos e de vítimas, baseiam-se no fato de todos os indivíduos, com exceção dos gêmeos idênticos, apresentarem diferenças nas suas sequências de bases nitrogenadas.

02. Os genes que codificam proteínas exercem sua função com uma de suas fitas servindo de molde para a síntese de RNA mensageiro.

04. Entre todos os tipos de RNA produzidos pela célula, o RNA mensageiro é o único que é sintetizado tendo como molde uma sequência de bases do DNA.

08. Duas moléculas de DNA dupla-hélice com a mesma sequência de bases têm, necessariamente, a mesma proporção de bases.

16. Durante a síntese de proteínas, cada trinca de bases do RNA mensageiro, denominada códon, especifica uma trinca de aminoácidos na tradução.

32. Os arranjos com repetição dos quatro tipos de bases nitrogenadas do RNA mensageiro (Adenina, Guanina, Citosina e Uracila), tomadas três a três, correspondem aos 64 códons de três letras do código genético. Se o RNA mensageiro fosse formado por cinco tipos de bases, seriam possíveis 128 códons de três letras.

64. O mesmo código genético é válido para os genes dos cromossomos dos coelhos e para os genes dos cromossomos da alface.

Soma das alternativas corretas:

13. (IFSul) Em 1962, o premio Nobel de Fisiologia e Medicina foi concedido aos cientistas Francis Crick, Maurice Wilkins (britânicos) e James Watson (norte-americano) por suas pesquisas que determinaram a estrutura molecular do DNA. Sobre o DNA, são feitas as seguintes afirmativas:

I. Possui estrutura em dupla hélice, encontrada no núcleo celular, e sua importância reside no fato de que ele carrega os genes.

II. No emparelhamento das fitas de DNA; se em uma fita tivermos a sequencia de bases AATTTCG, na outra teremos TTAAAGC.

III. É formado por uma pentose denominada desoxirribose e pelas bases nitrogenadas adenina, timina, citosina, guanina e uracila.

IV. Em alguns vírus, são encontrados ácidos nucleicos do tipo DNA espalhados no citoplasma viral.

Estão corretas apenas as afirmativas:

a) I e II.

b) I, II e III.

c) III e IV.

d) I, III e IV.

14. (UERJ) As características abaixo são referentes aos processos de replicação, transcrição e tradução, que ocorrem em seres vivos.

I. A síntese de proteínas tem início antes mesmo do término da transcrição.

II. A grande maioria dos genes contém íntrons, retirados antes da tradução.

III. A síntese de proteínas sempre ocorre em ribossomos livres no citoplasma.

IV. O processo de replicação possui uma única origem.

As características I, II, III e IV estão associadas, respectivamente, aos organismos indicados em:

a) Eucariotos – eucariotos – procariotos – eucariotos.

b) Eucariotos – procariotos – eucariotos – procariotos.

c) Procariotos – eucariotos – procariotos – procariotos.

d) Procariotos – procariotos – eucariotos – procariotos.

15. (IFSuldeMinas) Leia o texto abaixo:

“Carta sobre descoberta de DNA vendida por 4 milhões de euros: em 1953, Francis Crick dirigiu uma carta ao seu filho de 12 anos para comunicar a descoberta da estrutura DNA, já retratada por Wilkins e Franklin por difração de raios-X. A carta foi vendida num leilão, em Nova Iorque, por 4 milhões de euros. Há 60 anos, Crick enviou esta missiva de sete páginas onde explicava o que era o ácido desoxirribonucleico (DNA) e enumerava as quatro bases que o componham, descoberta feita com o seu colega James Watson, ambos ganhadores do Prémio Nobel. Uma frase da carta diz: “cremos ter descoberto o mecanismo básico de cópia pelo qual a vida surge da vida. Como deves imaginar, estamos muito emocionados”.

                        Fonte: http://www.cienciahoje.pt/index.php?oid=57442&op=all. Acesso em 11 de Abril de 2013

A partir dos seus conhecimentos e tendo por base a descoberta abordada no texto apresentado, assinale a alternativa correta.

a) O DNA é composto por quatro bases nitrogenadas, que apresentam proporções iguais entre si.

b) As bases nitrogenadas do DNA são: A (adenina), U (uracila), G (guanina) e C (citosina).

c) Após essa descoberta, foi confirmada a previsão de muitos cientistas, que atribuíam às proteínas a portabilidade dos fatores genéticos.

d) O modelo proposto por Crick e Watson retratava uma estrutura tridimensional do DNA, na qual duas cadeias helicoidais se enrolavam em torno do mesmo eixo.

16. (UNIPAC) Na abertura da novela O Clone, aparece estilizada uma molécula de DNA. Abaixo, esquematizamos a molécula segundo o modelo proposto por James Watson e Francis Crick. Observe:

16

Assinale a alternativa incorreta, referente à molécula:

a) Em células eucariotas, o DNA está combinado com proteínas e organizado em fibras de cromatina no núcleo.

b) O DNA é constituído de milhares de ribonucleotídeos ligados à estrutura (a) através de pontes de hidrogênio.

c) O DNA armazena todas as informações genéticas necessárias para especificar a estrutura de proteínas.

d) Transcrição é a propriedade do DNA de servir de molde para gerar moléculas de RNAs.

e) No desenho acima, (b) e (c) representam, respectivamente, citosina e guanina.

17. (UFT) A figura a seguir representa uma dupla fita de DNA, com as seguintes características definidas: polaridades (5’ e 3’), ponto origem de replicação (Ori), direções de abertura das fitas e de síntese das novas cadeias de DNA (setas). Os fragmentos designados por A, B, C e D são as fitas moldes para o processo replicativo.

17

Com relação à replicação contínua e descontínua, marque a alternativa correta:

a) A replicação será contínua para os fragmentos A e C e descontínua para os fragmentos B e D.

b) A replicação será contínua para os fragmentos A e B e descontínua para os fragmentos C e D.

c) A replicação será contínua para os fragmentos B e D e descontínua para os fragmentos A e C.

d) A replicação será contínua para os fragmentos B e C e descontínua para os fragmentos A e D.

e) A replicação será contínua para os fragmentos A e D e descontínua para os fragmentos B e C.

18. (UECE) A anemia falciforme decorre de uma mutação específica no gene da beta-globina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGC

CCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG

GCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAA

GGAGACCAATAGAAACTGGGCATGT

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGC

CCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG

GCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAA

GGAGACCAATAGAAACTGGGCATGT

Para a tradução desses genes, é (são) necessário(s):

a) Somente o mRNA.

b) A fita complementar do DNA e o mRNA.

c) Somente o mRNA e o rRNA.

d) DNA, mRNA; tRNA e rRNA.

19. (UFV) A sequência dos cinco primeiros aminoácidos (aa), de um peptídeo em início de síntese, está representada abaixo. Na tabela, aparecem também representados alguns RNAs transportadores (tRNA) e seus respectivos aminoácidos.

19a

19b

Assinale a alternativa que contém o mRNA que traduziu a sequência de aminoácidos para formar o peptídeo:

a) 5 -AUG-CUC-CCC-CAA-GCA- 3.

b) 5 -CCC-CAA-GCA-CUC-AUG- 3.

c) 5 -CAA-GCA-GAG-UAC-CCC- 3.

d) 5 -GCA-CUC-GUU-AUG-CAA- 3.

e) 5 -UAC-GAG-GGG-GUU-CGU- 3.

20. (UEMG) Em 1940 os biólogos George Beadle e Eward Tatum anunciaram:

20

Esse anúncio indica que os biólogos descobriram:

a) A estrutura da molécula de DNA.

b) A sequência de bases do DNA.

c) O mecanismo de transcrição do código genético.

d) O papel biológico do Gene.

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE BOTÂNICA (VIII)

01. (UNICENTRO) Leia a afirmativa a seguir.

A geração duradoura da samambaia é o ______-que possui ______ formados por células ______, as quais sofrem divisão ______xe produzem ______xxque são células ______xque, uma vez em condições adequadas de umidade, germinam, dando origem a uma estrutura denominada ______xque é a geração efêmera da samambaia.

Com relação ao ciclo reprodutivo das samambaias, assinale a alternativa que apresenta, correta e respectivamente, os termos que preenchem as lacunas dessa afirmativa.

a) esporófito, esporângios, diploides, meiótica, esporos, haploides, gametófito.

b) esporófito, esporângios, diploides, mitótica, esporos, diploides, gametófito.

c) esporófito, esporângios, haploides, mitótica, esporos, diploides, gametófito.

d) gametófito, gametângios, haploides, mitótica, gametas, haploides, esporófito.

e) gametófito, gametângios, diploides, meiótica, gametas, haploides, esporófito.

02. (FAMERP) Analise os gráficos relativos ao cultivo de mudas da palmeira carnaúba hospedeira, Copernicia hospita, em dois ambientes diferentes, no estado do Ceará. Considere que as plantas estão submetidas às mesmas condições de luminosidade e irrigação ideais.

02

A análise dos dados permite concluir que as mudas cultivadas:

a) Na casa de vegetação apresentam menor taxa fotossintética.

b) A pleno Sol absorvem mais água do solo.

c) Na casa de vegetação perdem mais água por transpiração foliar.

d) A pleno Sol fecham seus estômatos em torno do meio-dia.

e) Na casa de vegetação transportam maior quantidade de seiva bruta pelo xilema.

03. (UFRN) Pode-se observar na figura o aprisionamento de um inseto, pelas folhas articuladas da espécie de planta carnívora do gênero Dionaea.

03

(Disponível em: http://arquivosreporter.blogspot.com.br/2013/11/armadilha-da-natureza.html.)

Esse movimento, em resposta do toque feito pelo animal, é um exemplo de:

a) Tropismo.

b) Nastismo.

c) Geotropismo.

d) Tigmotropismo.

04. (UPE) Subir a Ilha de Trindade é voltar ao tempo. Distante aproximadamente 1.200 km do Estado do Espírito Santo, possui uma flora bastante peculiar, que, em formação, se assemelha às primeiras florestas do planeta. Dominada por uma espécie endêmica, conhecida como Cyathea copelandii, tem porte baixo, cujo tecido lenhoso, denominado caudex, é formado externamente por pecíolos endurecidos das frondes antigas, revestindo o rizoma. A base do caudex está geralmente na horizontal, mas, a partir da metade em diante, a planta é ereta. As folhas divididas em folíolos surgem enroladas, e sua reprodução é sexuada. Por causa da introdução de cabritos na ilha, a espécie quase desapareceu. Depois da retirada dos animais, hoje é possível perceber uma leve recuperação (foto), com algumas árvores adultas e prótalos colonizando o solo desnudo e aumentando, na ilha, a área dessa floresta típica.

04

(Disponível em: casopis.vesmir.cz/files/obr/id/4092/type.html)

Essas características permitem classificar Cyathea copelandii em

a) Criptógama vascular e Pteridófita.

b) Criptógama avascular e Briófita.

c) Fanerógama angiosperma e Dicotiledônea.

d) Fanerógama gimnosperma e Conífera.

e) Fanerógama angiosperma e Monocotiledônea.

05. (CEFET-MG) Sobre os órgãos vegetais e suas funções, é incorreto afirmar que determinadas(os):

a) Caules efetuam as trocas gasosas.

b) Folhas realizam reprodução assexuada.
c) Raízes desempenham o papel de fixação.

d) frutos executam o processo de fecundação.

06. (UEPG) A fisiologia vegetal aborda questões dos fatores ambientais na nutrição da planta; o sistema de transporte de seiva; como os hormônios vegetais comandam as reações da planta; a fisiologia do crescimento e Desenvolvimento, entre outros. Na fisiologia das angiospermas, assinale o que for correto.

01. Segundo a teoria da coesão-tensão, também conhecida como teoria de Dixon, a seiva bruta é puxada desde as raízes até as folhas, devido fundamentalmente à transpiração das folhas. As células das folhas, ao perderem água por evaporação, têm sua pressão osmótica aumentada e retiram água das células vizinhas, que por sua vez, terminam por retirar água das terminações dos vasos xilemáticos.

02. Quando o solo está encharcado e a umidade do ar é elevada, as células-guarda do estômato absorvem água e o ostíolo se fecha.

04. A falta do nitrogênio limita drasticamente o crescimento das plantas. Embora seja o elemento químico mais abundante da atmosfera, as plantas não conseguem utilizar diretamente o gás N2 atmosférico.

08. O CO2 necessário à fotossíntese é absorvido pela planta pelos traqueídes dos elementos de vaso.

16. O ponto de saturação luminosa da fotossíntese ocorre quando a planta está em condições precárias de temperatura e CO2.

Soma das alternativas corretas:

07. (CEFET-MG) Analise a imagem seguinte que mostra um vaso de planta submetida à iluminação difusa que tombou, sem prejudicá-la, permanecendo por alguns dias nessa posição.

07

Disponível em: <http://getting-in.com/&gt;. Acesso em 14 abr 2014.

Nessas condições, a mudança de orientação da planta, explica-se pela (o):

a) Movimento do caule em direção à fonte de luz.

b) Crescimento da porção aérea contra a gravidade.

c) Curvatura normal do caule dessa espécie de planta.

d) Tentativa de estabelecimento do equilíbrio estático pela planta.

e) Orientação paralela dos ramos dessa espécie em relação ao solo.

08. (UPF) Na reprodução dos vegetais com sementes, ocorre a denominada dupla fecundação. Isso significa que:

a) As células envolvidas na reprodução dividem-se duas vezes consecutivamente, para formarem o embrião diploide.

b) Um dos núcleos espermáticos se junta ao núcleo da oosfera e forma o embrião (2n); o outro núcleo espermático funde-se aos dois núcleos polares, resultando no endosperma (3n).

c) Cada núcleo espermático sofre duas divisões e cada uma das quatro células resultantes fecundará uma célula da oosfera.

d) O núcleo da oosfera é fecundado por dois núcleos espermáticos do pólen.

e) Um dos núcleos espermáticos, ao juntar-se ao núcleo da oosfera, forma um embrião (3n), enquanto o outro se junta a um dos núcleos polares e dá origem ao endosperma (2n).

09. (UEM) Sobre a absorção de água e de sais minerais e sobre o mecanismo de transporte da seiva bruta e elaborada nos vegetais, assinale a(s) alternativa(s) correta(s).

01. De acordo com a teoria da coesão-tensão, os processos de absorção e de condução da seiva bruta estão relacionados com a transpiração.

02. A pressão positiva da raiz é responsável pela condução da água e dos sais minerais até as folhas das árvores de grande porte.

04. A seiva elaborada é conduzida das folhas para as diversas partes da planta pelos elementos crivados, ou vasos liberianos do floema.

08. O fluxo da seiva orgânica dentro do corpo vegetal ocorre dos órgãos de alta pressão osmótica para os de baixa pressão osmótica.

16. Retirando-se um anel completo ao redor do caule de uma planta, em uma profundidade que vai até o câmbio vascular, a mesma irá morrer por falta de água para realização da fotossíntese.

Soma das alternativas corretas:

10. (UERN) No ciclo de vida das pteridófitas, os esporos liberados atingem o solo e podem desenvolver os gametângios, também conhecidos como prótalos. No mesmo individuo, os prótalos diferenciam-se em masculinos e femininos sendo, portanto, hermafrodita. A figura representa o prótalo e suas estruturas. Observe.

10

Assinale a afirmativa correta.

a) Os arquegônios (II) produzem as oosferas – gametas femininos.

b) Os arquegônios (I) produzem os anterozoides – gametas masculinos.

c) Na posição II estão os anterídios, que produzem os anterozoides – gametas masculinos.

d) Os anterídios estão na posição I, o arquegônio na posição II e os rizoides na posição III.

11. (FURG-RS) Dicotiledôneas e monocotiledôneas são duas classes de angiospermas. O que caracteriza as monocotiledôneas é:

a) Raiz fasciculada, folhas paralelinérveas, flores geralmente trímeras, fruto com um cotilédone.

b) Raiz fasciculada, folhas paralelinérveas, flores geralmente pentâmeras, sementes com dois cotilédones.

c) Raiz fasciculada, folhas peninérveas, flores geralmente tetrâmeras, fruto com um cotilédone.

d) Raiz axial, folhas peninérveas, flores somente pentâmeras, fruto com um cotilédone.

e) Raiz axial, folhas peninérveas, flores tetrâmeras e pentâmeras, sementes com dois cotilédones.

12. (UNEMAT) A professora Celice Alexandre, da UNEMAT de Tangará da Serra, publicou recentemente, em parceria com Ana Kelly Koch, um livro sobre as orquídeas de Mato Grosso. Esse exuberante grupo de monocotiledôneas é um dos mais diversificados entre os vegetais. Sobre as orquídeas, marque a alternativa correta:

a) Orquídeas são epífitas, ou seja, parasitas de outras plantas sobre as quais elas vivem.

b) Outras monocotiledôneas são as gramíneas, as palmeiras e os pinheiros.

c) A raiz das orquídeas é do tipo pivotante ou axial.

d) No ciclo de vida vegetal, as orquídeas representam a fase haploide.

e) A competição por luz é um dos fatores que explica o porquê de muitas orquídeas serem epífitas.

13. (UniEvangélica) Observe a figura a seguir.

13

Disponível em: <http://www.educador.brasilescola.com&gt;. Acesso em 04 out. 2012.

Na germinação de uma semente de dicotiledônea, podemos notar que inicialmente aparecem duas pequenas pontas, em posições opostas. Uma delas, que cresce voltada para baixo, é a primeira raiz; a outra, voltada para cima, é o caule, em cuja extremidade são visíveis as duas primeiras folhas (cotilédones) que envolvem o botão ou gema apical.

CAMPBELL, Neil et al. Biologia. 8. ed. Porto Alegre: Artmed, 2010. p. 809.

Considerando o crescimento da planta, geotropismo positivo e geotropismo negativo podem ser relacionados, respectivamente:

a) Ao crescimento da raiz, que cresce voltada para baixo; e ao crescimento do caule, que cresce voltado para cima.

b) Ao crescimento do caule, que cresce voltado para cima; e ao crescimento da raiz, que cresce voltada para baixo.

c) Ao crescimento normal do caule em direção à luz; e ao crescimento anormal do caule.

d) Ao crescimento normal da raiz em direção à fonte de água no subsolo; e ao crescimento inadequado da raiz por não encontrar água no subsolo.

14. (UFJF) O milho, o arroz e o trigo figuram entre as principais espécies vegetais de interesse econômico utilizadas na alimentação humana e animal. Essas espécies vegetais apresentam, em comum, os seguintes caracteres foliares:

a) Folhas peninérveas, simples e pecioladas.

b) Folhas paralelinérveas, compostas e pecioladas.

c) Folhas peninérveas, compostas e invaginantes.

d) Folhas paralelinérveas, simples e invaginantes.

15. (UFRRJ) O ciclo reprodutivo representado a seguir é de:

15

a) Talófita.

b) Gimnosperma.

c) Pteridófita.

d) Briófita.

e) Angiosperma.

16. (PUC-RS) A floresta ombrófila mista, também conhecida como mata-de-araucária, ocorre em áreas de altitude do planalto meridional do Brasil. Como elementos característicos, encontram-se o pinheiro-brasileiro (Araucaria angustifolia), de onde se obtém o pinhão, e a samambaiaçu (Dicksonia selowiana), de onde se extraía o xaxim para a confecção de vasos para plantas. Segundo a classificação tradicional dos seres vivos, o pinheiro-brasileiro e a samambaiaçu são, respectivamente,

a) Angiosperma e Gimnosperma.

b) Angiosperma e Pteridófita.

c) Gimnosperma e Briófita.

d) Gimnosperma e Pteridófita.

e) Pteridófita e Gimnosperma.

17. (PUC-MG) A presença de diversos tipos de pelos nos vegetais lhes proporciona uma melhor adaptação ao meio ambiente. São processos relacionados com a presença de pelos vegetais, exceto:

a) Proteger contra ataques de animais.

b) Facilidade de dispersão de frutos e sementes.

c) Aumento no poder de absorção de água e sais.

d) Facilitar a perda de água em excesso, acumulada nos parênquimas.

18. (UFLA) O esquema abaixo representa um corte histológico de uma folha em vista lateral:

18

As funções das estruturas indicadas no esquema em 1, 2, 3 e 4 são:

a) 1 – Proteção; 2 – transpiração; 3 – circulação; 4 – fotossíntese.

b) 1 – Proteção; 2 – fotossíntese; 3 – circulação; 4 – trocas gasosas.

c) 1 – Trocas gasosas; 2 – proteção; 3 – fotossíntese; 4 – circulação.

d) 1 – Fotossíntese; 2 – proteção; 3 – trocas gasosas; 4 – transpiração.

19. (URCA) A principal estrutura de dispersão de propágulos entre os vegetais é o fruto. Sobre essa estrutura das angiospermas é incorreto:

a) Tem origem a partir do ovário da flor.

b) A semente está envolvida pelo endocarpo, geralmente.

c) A azeitona é um exemplo de drupa.

d) O abacate é um exemplo de baga.

e) A castanha é o fruto do cajueiro.

20. (UNIOESTE) É muito frequente desenvolverem-se algumas partes da flor que se tornam carnosas, em substituição ao ovário, e são denominadas pseudofrutos. Neste caso, o ovário com as sementes, embora reduzido, vai originar o verdadeiro fruto, que, em geral, não é comestível. Assinale a alternativa que possui apenas exemplos de pseudofrutos múltiplos.

a) Caju (Anarcadium ), maçã (Malus spp.), morango (Fragaria spp.).

b) Morango (Fragaria ), amora (Rubus spp.), figo (Ficus spp.).

c) Figo (Ficus ), abacaxi (Ananas spp.), caju (Anarcadium spp.).

d) Amora (Rubus ), figo (Ficus spp.), abacaxi (Ananas spp.).

e) Amora (Rubus ), maçã (Malus spp.), morango (Fragaria spp.).

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE BIOTECNOLOGIA (IV)

01. (UPE) Antigamente, seria impensável um híbrido de tal natureza, a não ser no nosso imaginário. Com o avanço das novas tecnologias, é possível combinar partes do genoma de qualquer ser vivo com outro de reinos iguais ou diferentes.

01

                Disponível em: http://ultimaquimera.com.br/category/charges. Adaptado.

Qual dos exemplos a seguir retrata um caso de transgenia?

a) Cabra com gene de hormônio de crescimento humano.

b) Cruzamento de jumento com égua resultando em uma mula.

c) Serpente com gene para toxina hemorrágica de peçonha.

d) Uma gema ou borbulha de tangerina inserida em um porta-enxerto de limão cravo.

e) Videira de uva com semente, com gene de suscetibilidade à virose do enrolamento da folha.

02. (UFT) É correto afirmar que a obtenção de organismos transgênicos se deve à:

a) Degeneração do código genético.

b) Estrutura do DNA de fita dupla.

c) Informação genética contida no DNA.

d) Universalidade do código genético.

03. (PUC-MG) Assinale a afirmativa incorreta.

a) A ativação do duplo processo de imunização depende de células do sistema imune denominadas linfócitos.

b) O resultado do processo de vacinação é a produção de anticorpos que reconhecem as partículas antigênicas.

c) O processo de inserção de um gene do protozoário no material genético do vírus é denominado de clonagem genômica.

d) O interesse em desenvolver uma vacina contra o mal de Chagas se deve ao fato de essa doença ainda constituir em problema de saúde pública, causado pela domiciliação dos vetores, provocada pela desagregação ambiental.

04. (UFRN) Como fazer um salmão comum virar um gigante? O segredo é pegar do Chinook (Salmão originário da Europa) um trecho de DNA denominado promotor do hormônio de crescimento e inseri-lo na célula ovo do salmão do Atlântico Norte. A sequência promotora controla, indiretamente, a produção de proteína que, nesse caso, é a do hormônio de crescimento. Enquanto o salmão oceânico só produz o hormônio do crescimento no verão, o híbrido produz o ano inteiro. Depois da inserção do DNA do Chinook no salmão do Atlântico Norte, este passa a ser:

a) Quimera, pois ocorreu a clivagem dos dois alelos do gene que codifica a produção do hormônio do crescimento.

b) Clone, pois esse organismo foi gerado artificialmente a partir de óvulos não fecundados, conferindo-lhe vantagens quanto ao seu desenvolvimento.

c) Animal transgênico, pois se trata de um organismo que contém materiais genéticos de outro ser vivo, com vantagens em relação ao seu tamanho.

d) Organismo geneticamente modificado, pois a inserção do DNA promotor do hormônio do crescimento produz cópias idênticas do salmão gigante.

05. (UEA) Com o desenvolvimento da biotecnologia, a ciência é capaz de produzir, por meio das bactérias, moléculas idênticas às humanas, utilizadas como medicamentos. A insulina e o hormônio do crescimento já são produzidos, por exemplo, por essa técnica. Tal procedimento é conhecido como tecnologia do DNA recombinante. A figura representa uma bactéria e suas principais estruturas.

05

A manipulação genética desse organismo para a produção de transgênicos ocorre por:

a) Inserção de genes humanos no plasmídeo.

b) Transferência de cromossomos humanos para o citoplasma.

c) Ativação do DNA recombinante por meio das proteínas da membrana.

d) Inoculação de fragmentos de RNAm no nucleoide.

e) Mapeamento do ácido nucleico dos ribossomos.

06. (UEG) Os organismos transgênicos são produzidos pela transferência de um gene de interesse, contido em um fragmento de DNA, para o zigoto de um organismo-alvo. As moléculas que cortam o fragmento de DNA em pontos específicos são:

a) Agentes químicos que atuam em pH extremo.

b) Catalisadores denominados enzima de restrição.

c) Polimerizadores termoestáveis de nucleotídeos.

d) Solventes orgânicos desnaturantes de DNA.

07. (UPE) Para responder esta questão, leia o texto a seguir:

O jumento não é mais o mesmo. Animal rústico e com fama de teimoso, a espécie está cada vez mais valorizada. Alguns animais recebem tratamento de primeira linha, com direito à transferência de embriões, inseminação artificial e congelamento de sêmen. Um bom jumento reprodutor, da raça pêga, vale até R$ 20 mil. O criador de asininos, Osmar Russo (Lorena, SP), diz que o mercado nunca esteve tão bom. “A maioria dos jumentos é vendida para produzir muares (burros e mulas). Um bom reprodutor precisa ter orelha bonita e grande, ser marchador, forte, resistente e manso. Mas o principal é imprimir as características às crias. Separo os melhores animais e cruzo com matrizes boas também. Meus animais nem se comparam aos de antigamente. Algumas jumentas, que mediam em torno de 1,3 metro, agora chegam a 1,4 metro.” Antigamente usavam-se os piores animais para obter muares. Hoje, os cruzamentos são com éguas das raças manga-larga, mangalarga marchador e campolina.

Disponível em: http://www.estadao.com.br/noticias/suplementos (Adaptado)

De acordo com os dados do texto, o processo que consiste em selecionar, alterar  geneticamente e aprimorar a qualidade dos jumentos, de modo a atender as necessidades humanas, é conhecido como:

a) Autofecundação.

b) Clonagem molecular.

c) Endogamia.

d) Melhoramento genético.

e) Terapia gênica.

08. (UEM) Sobre a eletroforese de DNA, é correto afirmar que:

01. É realizada utilizando-se uma placa com gel especial, fragmentos de DNA e aplicação de corrente elétrica.

02. Os fragmentos de DNA que possuem cargas negativas se deslocam para o polo positivo, quando é aplicada uma descarga elétrica na placa de gel.

04. A eletroforese de DNA tem sido utilizada para a identificação de pessoas, nas investigações policiais, em processos judiciais e na determinação da paternidade.

08. Gêmeos monozigóticos podem ser distinguidos pela análise do DNA nuclear.

16. Os fragmentos separados por eletroforese são formados por DNA com cadeia dupla.

Soma das alternativas corretas:

09. (UCPel) A engenharia genética é considerada como uma extensão dos cruzamentos seletivos, pois ambas tecnologias juntam o material de diferentes origens para criar organismos que possuem novas características. Com relação à engenharia genética, pode-se afirmar o seguinte:

I. A transferência do gene de um organismo para outro ocorre através de um pequeno fragmento de DNA chamado vetor, que pode ser um plasmídeo ou um vírus.

II. A possibilidade de transferência de genes é ilimitada entre organismos de diferentes espécies.

III. Nesta tecnologia, faz-se a transferência de um gene conhecido.

IV. O vetor utilizado deve conter uma origem de replicação, o que permite sua duplicação no hospedeiro.

V. Uma das aplicações da engenharia genética é a produção de insulina.

Considerando as afirmativas anteriores, assinale a opção correta.

a) Todas as afirmativas estão incorretas.

b) Estão corretas somente as afirmativas II e V.

c) Está correta somente a afirmativa I.

d) Todas as afirmativas estão corretas.

e) Estão corretas somente as afirmativas II, IV e V.

10. (UFSJ)   Leia o texto abaixo.

“Os impactos dos organismos geneticamente modificados abordados sob as dimensões agronômica, ecológica, cultural, social e política no livro “Transgênicos para quem? Agricultura, Ciência, Sociedade” estão na obra que será lançada no próximo dia 28, durante o Fórum Social Temático 2012, em Porto Alegre(RS). A publicação, que reúne artigos de diversos pesquisadores brasileiros e franceses, foi organizada por Magda Zanoni, bióloga, socióloga e pesquisadora do laboratório Dynamiques Sociales et Recomposition des Espaces (Centro Nacional de Pesquisa Científica – CNRS, França); e por Gilles Ferment, mestre em ecologia e gestão ambiental, e consultor do Núcleo de Estudos Agrários e Desenvolvimento Rural do Ministério do Desenvolvimento Agrário (NEAD/MDA). […]

“Transgênicos para quem?” é apresentado em três partes. A primeira aborda as incertezas científicas inerentes ao uso das biotecnologias modernas de reprogramação dos seres vivos e seus possíveis efeitos nocivos ao meio ambiente e à saúde humana. A segunda parte, “Transgênicos: O necessário enfoque multidisciplinar” se divide em mais três temas que discutem os embates agronômicos, ecológicos, políticos, institucionais, jurídicos, econômicos e sociais dos transgênicos. A última, “Atores sociais: resistências e cidadania”, discute o papel da sociedade civil no debate do uso dos transgênicos.

A publicação oferece uma diversidade de análises, destaca pontos de vista de agricultores familiares, cientistas internacionalmente conhecidos, estudantes, associações, cooperados e ativistas. O objetivo, segundo os organizadores, é trazer uma reflexão sobre a capacidade dos transgênicos de resolver as dificuldades atuais e futuras com as quais a sociedade e os agricultores familiares estão confrontados.

Transgênicos para quem? Integra a coleção NEAD.

Debate está disponível para download gratuito no Portal NEAD. Notícia publicada no site do Ministério do Desenvolvimento Agrário

Disponível em: (http://www.mda.gov.br/portal/noticias/item?item_id=9190597) Acesso em 18/jan./2012.

Sobre o interesse tecnológico na biologia molecular e suas técnicas, e na produção dos Organismos Geneticamente Modificados, (OGMs), é incorreto afirma que:

a) Os OGMs são organismos produzidos em laboratório com finalidades diversas, desde a produção de alimentos, medicamentos e para pesquisas científicas.

b) O interesse na produção agrícola de OGMs é a produção de vegetais mais sadios e resistentes a doenças.

c) A biotecnologia tem produzido OGMs com potencial risco à população e não há qualquer regulamentação no Brasil que controle seu cultivo, pesquisa e consumo.

d) O interesse nos OGMs é pelo uso da maquinaria genética das células para que elas produzam proteínas de interesse na agricultura, saúde, etc.

11. (UFU) A Escherichia coli  é o microrganismo mais estudado por cientistas no mundo todo, não somente pela importância de seu combate pelos órgãos promotores da saúde pública, devido às doenças intestinais causadas por essa bactéria, mas, fundamentalmente, porque a Escherichia coli  é muito utilizada em técnicas de engenharia genética. Na técnica do DNA recombinante, a Escherichia coli  é amplamente utilizada devido:

a) À facilidade de manipulação em laboratório do DNA cromossômico dessa bactéria não patogênica.

b) À incorporação de enzimas de restrição específicas para o genoma da Escherichia coli , que não podem ser utilizadas em outro material genético.

c) À presença do plasmídeo bacteriano, ao qual são incorporados genes de interesse econômico ou médico que passam a se expressar nas bactérias geneticamente modificadas, acarretando a produção de proteínas específicas.

d) Ao fato de ser o único microrganismo no mundo com o genoma mapeado, o que facilita seu estudo por parte dos pesquisadores.

12. Plantas, animais e microrganismos representam um patrimônio genético de extrema importância para o planeta, considerando também suas potencialidades biotecnológicas. Sobre este assunto, assinale a alternativa incorreta.

a) Para identificar genes de interesse, o DNA extraído das células pode ser e clonado artificialmente milhares de vezes através de uma reação em cadeia da polimerase (PCR).

b) Enzimas de restrição cortam o DNA de forma a produzir pequenos fragmentos cromossômicos com as sequências de nucleotídeos desejadas.

c) Antes de serem implantados em outros organismos, os genes de interesse são incluídos em plasmídios, que funcionam como unidades de transferência.

d) Plantas e animais transgênicos jamais possuirão a capacidade de se recombinar com espécies selvagens no ambiente.

e) Vacinas de DNA se constituem de genes do agente patológico que, após incluídos nas células do indivíduo vacinado, serão expressos e induzirão a produção de anticorpos contra os antígenos gerados.

13. (UEPG) Um organismo que recebe e incorpora, por meio da engenharia genética, um gene de outra espécie é dito transgênico. Com relação aos transgênicos, assinale o que for correto.

01. Na produção do transgênico, o geneticista deve isolar o gene a ser clonado e depois transferir esse para a outra espécie com auxílio da biotecnologia.

02. Um transgênico perde a capacidade de se reproduzir com a sua espécie, o que evita a fuga de genes tão temida pelos ambientalistas.

04. Na biotecnologia, jamais os geneticistas conseguiriam transferir genes de animais para plantas, pois são estruturas completamente diferentes.

08. A transgenia somente obtém sucesso se o gene a ser clonado se inserir no genoma alvo e ali for capaz de realizar suas funções.

Soma das alternativas corretas:

14. (UESPI) As técnicas de clonagem têm produzido uma série de avanços biotecnológicos; contudo não são ferramentas com potencial aplicação:

a) Na conservação do patrimônio genético de plantas e animais sob perigo de extinção.

b) Na criação de plantas cultivadas resistentes a pragas agrícolas.

c) Na síntese de fármacos de interesse humano em bactérias transgênicas.

d) Na produção de seres humanos para fins de transplantes de órgãos.

e) No crescimento de nervos em pessoas com lesões na coluna cervical.

15. (ENADE) As endonucleases de restrição são utilizadas para a obtenção de fragmentos de DNA que contêm os genes. A obtenção do gene D, tendo como base o mapa abaixo, seria possível por digestão com:

15

a) Bg/II.

b) Sa/I.

c) Bam

d) BamHI + Sa/I.

e) Bg/II + Sa/I.

16. (UEM) Em 1994, nos Estados Unidos, iniciou-se a comercialização do tomate longa vida, o primeiro produto agrícola transgênico. Atualmente, são consumidos, na alimentação humana e de animais, cerca de 600 produtos geneticamente modificados. O processo de produção de produtos transgênicos é possível porque:

a) Ocorre recombinação gênica nas espécies.

b) Ocorre transferência de todos os cromossomos de uma espécie para outra.

c) Ocorre transferência de partes do DNA de uma espécie para outra.

d) Existem enzimas de restrição que permitem a incorporação dos genes de outras espécies.

e) Hormônios induzem a troca de genes entre as bactérias e as espécies infectadas.

17. Uma loja de animais mantinha para venda 4 exemplares de Ara ararauna  (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro, a partir de um casal mantido em um criatório autorizado pelo IBAMA. Contudo, os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. Para esclarecer a questão, colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint, ou “impressão digital de DNA”. O DNA foi extraído das células por processos químicos, fragmentado com enzimas de restrição, colocado sobre um gel suporte e submetido à corrente elétrica. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel, que podem ser visualizadas por tratamentos específicos. O padrão de bandas é exclusivo de cada indivíduo. A ilustração a seguir apresenta o resultado do teste.

17

Os resultados obtidos permitem deduzir:

I    II

0   0 – Que o filhote 4 pode ser filho do casal mantido pelo criador.

1   1 – Que o filhote 3 pode ser filho do casal mantido pelo criador.

2   2 – Que o filhote 2 pode ser filho do casal mantido pelo criador.

3   3 – Apenas os exemplares machos podem ser filhos do casal mantido pelo criador.

4   4 – Apenas os exemplares fêmeas podem ser filhos do casal mantido pelo criador.

18. (I OLIMPÍADA BRASILEIRA DE BIOLOGIA) Um horticultor deseja obter indivíduos geneticamente idênticos (clones) a uma samambaia comercialmente valiosa. Para alcançar esse objetivo ele deve:

a) Cultivar os esporos produzidos por essa samambaia.

b) Induzir artificialmente a autofecundação dessa samambaia.

c) Implantar núcleos de esporos dessa samambaia em oosferas anucleadas de outras plantas.

d) Introduzir DNA extraído de folhas dessa samambaia em zigotos de outras plantas.

e) Obter fragmentos de rizoma (caule) dessa samambaia e cultivá-los.

19. (FMJ) Considere duas situações hipotéticas:

1ª SITUAÇÃO: “Maria manteve relações sexuais com dois irmãos, gêmeos dizigóticos (falsos), nascendo destas relações Alfredo”

2ª SITUAÇÃO: “Paula engravidou ao manter relações sexuais com dois irmãos gêmeos monozigóticos (verdadeiros), nascendo Renato.”

Abandonadas e tristes, ambas reclamam na justiça o reconhecimento de paternidade, determinando o juiz a realização dos testes de DNA. Após receber os resultados, a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade de outra. A análise das situações nos permite concluir que o exame de DNA:

a) Não permitiu que o juiz identificasse Alfredo como filho de um dos gêmeos dizigóticos.

b) Permitiu que o juiz identificasse Renato como filho de um dos gêmeos monozigóticos.

c) Permitiu que o juiz identificasse Alfredo como filho de um dos gêmeos dizigóticos.

d) Permitiu identificar quem era o pai de filho de Paula.

e) Não permitiu identificar quem era o pai do filho de Maria.

20. (PUC-SP) Os organismos são ditos transgênicos quando, por técnica de engenharia genética, recebem e incorporam genes de outra espécie, os quais podem ser transmitidos aos seus descendentes. Exemplos desses organismos são as plantas transgênicas, receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas. Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora, diversas condições devem ser observadas. Entretanto, fundamentalmente, essa técnica é possível porque:

a) Cada organismo apresenta seu próprio código genético.

b) O código genético é comum a todos os seres vivos.

c) O código genético é degenerado.

d) A técnica permite trocar o código genético do organismo doador do gene.

e) A técnica permite trocar o código genético do organismo receptor.

gab

 

« Newer Posts - Older Posts »

Categorias

Seguir

Obtenha todo post novo entregue na sua caixa de entrada.

Junte-se a 511 outros seguidores