Publicado por: Djalma Santos | 19 de outubro de 2015

TESTES DE MITOSE (5/5)

01. (FEI) No processo de mitose:

a) A partir de uma célula diploide originam-se duas novas células diploides.

b) A partir de uma célula diploide originam-se quatro novas células diploides.

c) A partir de uma célula haploide originam-se duas novas células diploides.

d) A partir de uma célula haploide originam-se quatro novas células diploides.

e) A partir de uma célula diploide originam-se quatro novas células haploides.

02. (FaZU) Entre as frases abaixo em relação à divisão celular por mitose, uma é incorreta. Aponte-a:

a) Na metáfase, todos os cromossomos, cada um com duas cromátides, encontram-se no equador da célula em maior grau de condensação.

b) A célula mãe dá origem a duas células filhas com metade do número de cromossomos.

c) As células filhas são idênticas às células mãe.

d) Ocorre nas células somáticas tanto de animais como de vegetais.

e) É um processo muito importante para o crescimento dos organismos.

03. (UNITAU) Nas células somáticas da espécie humana, a separação dos centrômeros e os fenômenos de duplicação do DNA ocorrem na:

a) Interfase e anáfase.

b) Prófase e anáfase.

c) Metáfase e telófase.

d) Interfase e telófase.

e) Metáfase e prófase.

04. (UEL) Analise o gráfico a seguir:

04

O momento em que a célula-mãe acabou de se dividir e cada célula-filha tem um conjunto de cromossomos idêntico ao da original é:

a) 1.

b) 2.

c) 3.

d) 4.

e) 5.

05. (COVEST) Considere as seguintes fases de uma célula em divisão.

05

A sequência correta de eventos na mitose é:

a) 4, 1, 2, 5 e 3.

b) 3, 4, 1, 2 e 5.

c) 4, 3, 2, 1 e 5.

d) 1, 2, 4, 3 e 5.

e) 1, 2, 3, 4 e 5.

06. (UNISA-SP) Quando se inicia a mitose, os cromossomos começam a se condensar:

a) Já estando duplicados desde a interfase precedente, sendo que o máximo de condensação é observado na metáfase.

b) Duplicam-se durante a metáfase, separando-se na anáfase.

c) A condensação máxima é na telófase.

d) A condensação termina na metáfase, ocorrendo a duplicação dos mesmos na anáfase.

e) Duplicam-se na interfase, apresentando um máximo de condensação no período G.

07. O gráfico mostra a variação da quantidade de DNA de uma célula somática durante as diversas fases de sua vida.

07

No gráfico, a mitose propriamente dita e a interfase correspondem, respectivamente, aos intervalos de tempo:

a) 4 a 6 e 1 a 4.

b) 2 a 4 e 3 a 5.

c) 3 a 5 e 1 a 3.

d) 1 a 3 e 4 a 6.

e) 2 a 5 e 3 a 5.

08. (UNIFOR) Considere as fases do ciclo celular e os eventos a seguir:

I. Interfase

II. Anáfase mitótica

III. Metáfase mitótica

a. Duplicação do DNA

b. Disposição dos cromossomos na região mediana da célula

c. Separação das cromátides-irmãs que migram para polos opostos

A alternativa que associa corretamente essas fases com esses eventos é:

a) I-a ; II-b ; III-c.

b) I-a ; II-c ; III-b.

c) I-b ; II-a ; III-c.

d) I-b ; II-c ; III-a.

e) I-c ; II-b ; III-a.

09. (UNIRIO)

1. Telófase

2. Prófase

3. Metáfase

4. Interfase

(   ) Cromossomos na placa equatorial

(   ) Formação do fuso mitótico

(   ) Desaparecimento da membrana nuclear

(   ) Duplicação do DNA

(   ) Citocinese

A associação correta, de cima para baixo, entre as fases da mitose e os fenômenos que nelas ocorrem é:

a) 3, 1, 2, 4, 4.

b) 1, 2, 4, 3, 3.

c) 3, 2, 2, 4, 1.

d) 4, 4, 3, 2, 1.

e) 1, 3, 2, 1, 2.

10. (FUVEST) Mitose é o processo de divisão celular por meio do qual uma célula eucarionte origina, em sequência ordenada de etapas, duas células filhas geneticamente idênticas. Sobre tal processo foram feitas as seguintes afirmações.

I. Na interfase, os cromossomos se duplicam.

II. Na telófase, os cromossomos atingem o máximo de condensação.

III. Na prófase, cada cromossomo e constituído por dois filamentos unidos pelo centrômero.

IV. Na metáfase, ocorre o aparecimento do nucléolo e desespiralização dos cromossomos.

Está correto apenas o que se afirma em:

a) I e II.

b) I e III.

c) I e IV.

d) II e III.

e) II e IV.

11. (UDESC) Assinale a alternativa incorreta.

a) Durante o ciclo celular, ocorre duplicação de cromossomos e sua distribuição para as células-filhas.

b) Os cromossomos são formados por filamentos de DNA e proteínas.

c) Os cromossomos derivam de porções da cromatina que se condensaram formando partículas de forma e número bem definidos para cada espécie.

d) Mitose é o processo pelo qual as células dos seres eucariontes distribuem, em partes iguais, o DNA que foi duplicado durante a interfase para as duas porções do citoplasma que se dividiu.

e) A mitose é realizada por meio de duas divisões sucessivas.

12. (UFRGS) No esquema exposto está apresentada uma célula em anáfase da mitose. Observando-a, pode-se concluir que pertence a um organismo cujas células somáticas e gametas possuem, respectivamente:

12

a) 12 e 6 cromossomos.

b) 6 e 12 cromossomos.

c) 6 e 3 cromossomos.

d) 3 e 6 cromossomos.

e) 24 e 12 cromossomos.

13. (FEI-SP) Se a quantidade de DNA de uma célula somática em divisão é 2X, as células do mesmo tecido, nas fases G1 e G2, apresentam, respectivamente, as seguintes quantidades de DNA:

a) X e X.

b) X/2 e X.

c) X/2 e 2X.

d) X e X/2.

e) X e 2X.

14. (UFRGS) Observe o diagrama, apresentado, que representa o ciclo de vida de uma célula somática humana.

14

Em relação a esse ciclo, é correto afirmar que existem:

a) 23 moléculas de DNA em G1.

b) 23 moléculas de DNA em S.

c) 92 moléculas de DNA em G2.

d) 46 moléculas de DNA na prófase de mitose.

e) 23 moléculas de DNA na telófase de mitose.

15. (UEL) A figura abaixo representa cromossomos em uma célula somática que está sofrendo divisão celular. Com base nessa informação, assinale a alternativa que contém o número correto de moléculas de DNA, cromátides e cromossomos presentes nesta célula.

15a

15b

16. (UNIMONTES) A vincristina é uma droga usada no tratamento do câncer. Comprovadamente, ela inibe a completa formação da tubulina gerando, consequentemente, a dissolução dos microtubulos e inibição da formação do fuso mitótico. Com base nas informações disponibilizadas e nos conhecimentos associados, é correto afirmar que:

a) A droga bloqueará a mitose na prófase.

b) A mitose será interrompida na metáfase.

c) A mitose não ocorrerá, já que a interfase será bloqueada pela ação da droga.

d) A eficiência da droga é atestada pelo bloqueio da interfase.

17. (UEM) Acerca do significado da mitose para os seres vivos, assinale o que for correto.

01. Quando uma alga unicelular, uma ameba ou um paramécio se dividem por mitose, estão originando dois novos indivíduos. Para esses organismos formados por uma única célula, divisão celular significa reprodução.

02. Todos os organismos pluricelulares têm a mitose ocorrendo não apenas para o desenvolvimento, crescimento, renovação e regeneração, mas também para a reprodução.

04. No fim da telófase, em células animais e de alguns protozoários, tem início um processo de estrangulamento na região mediana que termina por dividir a célula. Por começar na periferia e avançar para o centro da célula, esse tipo de divisão citoplasmática é chamado de citocinese centrífuga.

08. Como a célula animal tem centríolo e forma áster, sua mitose é astral. A mitose da célula vegetal é anastral.

16. A mitose pode ocorrer com células de qualquer ploidia, n, 2n, 3n, etc. Todas originam células-filhas com o mesmo número de cromossomos da célula-mãe.

Soma das alternativas corretas:

18. (UEA) A figura traz cromossomos humanos fotografados em células durante o processo de divisão celular.

18

O cromossomo indicado na figura é formado por:

a) Duas fitas duplas de DNA condensadas na interfase.

b) Duas fitas simples de DNA condensadas na interfase.

c) Uma fita dupla de DNA condensada na prófase.

d) Duas fitas duplas de DNA condensadas na prófase.

e) Duas fitas simples de DNA condensadas na prófase.

19. (UEPG) A respeito da mitose, um dos processos fundamentais da divisão celular, em que uma célula se divide, originando duas células-filhas exatamente iguais à célula inicial no que toca à qualidade e à quantidade de material genético, assinale o que for correto.

01. Quando se estuda a mitose em células vegetais, percebem-se diferenças em relação ao processo que ocorre nas células animais. Inicialmente, não há centríolos nem ásteres; mesmo assim, ocorre a formação das fibras do fuso.

02. A mitose é um processo contínuo de divisão celular em que ocorre uma duplicação cromossômica para cada divisão celular. Assim, o número e a qualidade dos cromossomos da célula-mãe são mantidos nas células-filhas. A mitose se divide nas seguintes fases ou etapas: prófase, metáfase, anáfase e telófase.

04. A mitose permite que os organismos pluricelulares cresçam, por meio do aumento do número de células, e substituam células mortas. Assim, as células da nossa pele, de um embrião em desenvolvimento e das pontas das raízes e caules estão em constante mitose.

08. A divisão do citoplasma da célula vegetal não se processa por estrangulamento, como na célula animal. Em vez disso, aparece no equador da célula um esboço de parede, a lamela média, constituída por um polissacarídeo, a pectina. Mais tarde, formam-se duas membranas celulósicas, de um lado e do outro da lamela média.

Soma das alternativas corretas:

20. (UNIFESP) Analise a figura.

20

A figura representa um cromossomo em metáfase mitótica. Portanto, os números I e II correspondem a:

a) Cromossomos emparelhados na meiose, cada um com uma molécula diferente de DNA.

b) Cromátides não irmãs, cada uma com uma molécula idêntica de DNA.

c) Cromátides irmãs, cada uma com duas moléculas diferentes de DNA.

d) Cromátides irmãs, com duas moléculas idênticas de DNA.

e) Cromossomos duplicados, com duas moléculas diferentes de DNA.gab 

Publicado por: Djalma Santos | 19 de outubro de 2015

TESTES DE BIOELETROGÊNESE (2/3)

01. (UNIRIO) Quando um neurônio não está sendo estimulado, encontrando-se em repouso, temos em seu interior uma concentração maior de:

a) K+.

b) Ca++.

c) Na+.

d) Li+.

e) Cl.

02. Assinale a(s) alternativa(s) correta(s).

I   II

0  0 – Os tecidos em geral não obedecem à lei do tudo ou nada.

1  1 – No período refratário absoluto, a célula é incapaz de responder a um novo estímulo.

2  2 – No período refratário relativo, a célula é incapaz de responder a um estímulo.

3  3 – A partir da redistribuição iônica, a célula readquire o PMR.

4  4 – No potencial de ação da membrana, a célula está respondendo ao estímulo fornecido.

03. (UFJF)O processo elétrico que ocorre na transmissão do impulso nervoso:

a) Depende da despolarização da membrana plasmática e termina com a liberação do neurotransmissor na corrente sanguínea.
b) Depende do disparo de potenciais de ação e termina com a liberação de neurotransmissores pelos dendritos.
c) Ocorre sempre no sentido dendrito para o terminal axônico e depende do transporte de íons através da membrana plasmática.
d) Envolve a participação de diferentes tipos de permeases e depende principalmente da interação entre moléculas de actina e miosina.
e) É lento e termina com a liberação do neurotransmissor no citoplasma da célula adjacente.

04. (COVEST) O impulso nervoso é um fenômeno de natureza eletroquímica, autopropagado, que caminha pela membrana do neurônio. Com relação a esse assunto, podemos afirmar que:

I  II

0  0 – Ao ser estimulada, a membrana de um neurônio em repouso se “despolariza”. Na área estimulada, ocorre uma alteração momentânea na permeabilidade da membrana plasmática e a entrada de íons sódio.

1  1 – Ao período de despolarização, segue-se um período de repolarização,  em que o potássio se difunde para o meio extracelular. Posteriormente, a bomba de sódio e potássio restabelece os gradientes normais desses íons na célula.

2  2 – Se o estímulo for de baixa intensidade, inferior ao limiar de excitação, as alterações sofridas pelo neurônio serão suficientes apenas para gerar um impulso nervoso de baixa propagação.

3  3 – A membrana do neurônio em repouso é polarizada como uma pilha elétrica. Sua face interna representa o polo negativo, e a face externa funciona como polo positivo.

4 4 – Axônios amielínicos transmitem o impulso nervoso mais rapidamente que os mielinizados.

05. Assinale a(s) alternativa(s) correta(s).

I   II

0  0 – O limiar de excitação é igual para todas as células.

1  1 – A excitabilidade á variável numa mesma célula.

2  2 – A excitabilidade é variável nos diversos tipos celulares.

3  3 – A excitabilidade é constante para toda célula.

4  4 – A célula óssea, por exemplo, apresenta um baixo limiar de excitação.

06. Analise o esquema abaixo, que representa uma “parte” de um axônio em repouso, e assinale a(s) alternativa(s) correta(s).

06

I   II

0  0 – A ocorrência do impulso nervoso depende apenas de estímulos de natureza física.

1  1 – As concentrações dos íons Na+ e K+ diferenciadas são mantidas sem gasto de energia, sendo exemplo de transporte passivo.

2  2 – Se a membrana do neurônio for atingida por um estímulo, as quantidades de Na+ e K+, dentro e fora da membrana se igualam.

3  3 – A quantidade de íons K+ é menor na parte interna do neurônio devido a sua saída por difusão.

4 4 – Devido à diferença de cargas entre as faces externa e interna, o neurônio está polarizado.

07. Assinale a(s) alternativas correta(s):

I  II

0  0 – A redistribuição iônica independe das bombas de Na+ e K+.

1 1 – No período refratário relativo, que ocorre durante a inversão da polaridade, a célula é capaz de responde a um estímulo.

2 2 – A ocorrência do PMR (potencial de repouso da membrana) se deve à distribuição de íons nos meios intra e extracelular.

3 3 – O influxo de K+, em grande quantidade, determina a inversão da polaridade, que caracteriza o potencial de ação da membrana (PAM).

4  4 – Podemos relacionar a lei do tudo ou nada com irritabilidade e resposta.

08. Assinale a(s) alternativa(s) correta(s):

I  II

0  0 – Considerando-se  uma  fibra  nervosa,  um  estímulo  maximal   induzirá, certamente, uma resposta mais intensa que um estímulo minimal.

1 1 – O estímulo é capaz de transformar a condição celular que existe em potencial (excitabilidade) em condição ou estado dinâmico (excitação).

2  2 – No potencial de repouso a célula é inexcitável.

3  3 – O impulso nervoso é uma onda de modificações bioeletroquímicas.

4  4 – Quando em “repouso” a  célula apresenta  uma  eletronegatividade externa.

09. Assinale a(s) alternativa(s) correta(s):

I   II

0  0 – Na célula em “repouso” ocorre uma saída constante de sódio.

1  1 – Apenas as fibras nervosas obedecem à lei do tudo ou nada.

2  2 –  O potencial de repouso é  um fenômeno  exclusivo das  células musculares e nervosas.

3  3 – Os  estímulos subminimais,  mesmo  repetidos,  mostram-se  incapazes  de induzir uma resposta aparente.

4  4 – Em um  determinado neurônio,  o impulso elétrico  se propaga com a mesma intensidade, qualquer que seja a intensidade do estímulo acima do limiar mínimo.

10. No século XIX, Hermann von Helmholtz realizou um experimento usando o seguinte dispositivo.

10

Uma preparação de músculo de rã com o nervo ainda conectado a este foi montada, de forma que uma das extremidades do músculo ficasse presa a um suporte fixo e a outra a uma alavanca com uma “agulha” que tocava num tambor giratório de velocidade constante e conhecida. A “agulha” poderia assim registrar o movimento do músculo. Num primeiro momento, o nervo do músculo foi estimulado eletricamente na posição S1. O movimento da contração muscular foi então registrado no tambor giratório, gerando a curva 1. Em seguida, o nervo foi estimulado com a mesma intensidade na posição S2, sendo este estímulo aplicado no momento em que a “agulha” coincidia com o início da curva 1. Este segundo estímulo gerou a curva 2. Qual a característica do impulso nervoso que foi, teoricamente, medida nesse experimento?

a) A velocidade da repolarização.

b) A ação das bombas de sódio e potássio.

c) A velocidade de fechamento dos canais de potássio.

d) A velocidade de propagação do impulso nervoso ao longo da fibra nervosa.

e) O valor do potencial de ação.

11. (FAVIP) Aplicado um estímulo num ponto de um axônio, como ilustrado na figura, ocorrem os seguintes eventos:

11

1. A membrana torna-se muito permeável ao sódio (X), que passa do meio para o interior do axônio em maior quantidade do que os íons potássio (Y) saem do interior para o meio.

2. A membrana torna-se muito permeável ao potássio (X), que passa do meio para o interior do axônio em maior quantidade do que os íons sódio (Y) saem do interior para o meio.

3. A superfície da membrana, no ponto e no instante do estímulo, fica externamente negativa e internamente positiva; diz-se, então, que a membrana sofreu inversão de polaridade.

4. Os íons sódio (X) são expulsos, e a membrana volta à polaridade inicial.

Estão corretas apenas:

a) 1 e 4.

b) 2 e 3.

c) 1, 3 e 4.

d) 2, 3 e 4.

e) 1 e 3.

12. São estruturas que não obedecem à Lei do Tudo ou Nada.

I  II

0  0 – Células isoladas.

1  1 –  Músculo estriado cardíaco (miocárdio).

2  2 –  Músculo estriado esquelético.

3  3 –  As glândulas em geral.

4  4 – Célula muscular esquelética.

13. (UFAM) A figura a seguir representa um momento elétrico na vida de uma célula em uma junção muito especial chamada de placa motora. Se (A) representa o corpo celular de um neurônio-motor, (C) seu axônio e (B) o músculo gastrocnêmico, qual das seguintes afirmativas explica corretamente os fenômenos 1 e 2 que ocorrem na fibra muscular:

13

a) 1 indica a “despolarização” da membrana provocada pela abertura dos canais de Na+, enquanto que 2 indica a abertura dos canais de K+ e início da repolarização da membrana.

b) 1 indica a repolarização da membrana provocada pela abertura dos canais de Na+, enquanto que 2 indica a abertura dos canais de K+ e início da “despolarização” da membrana.

c) 1 indica a “despolarização” da membrana provocada pela abertura dos canais de K+, enquanto que 2 indica a abertura dos canais de Na+ e início da repolarização da membrana.

d) 1 indica a hiperpolarização da membrana provocada pela abertura dos canais de Na+, enquanto que 2 indica a abertura dos canais de K+ e início da “despolarização” da membrana.

e) 1 indica a “despolarização” da membrana provocada pelo fechamento dos canais de Na+, enquanto que 2 indica o fechamento dos canais de K+ e início da repolarização da membrana.

14. (FUVEST) Na telefonia celular, a voz é transformada em sinais elétricos que caminham como ondas de rádio. Como a onda viaja pelo ar, o fio não é necessário. O celular recebe esse nome porque as regiões atendidas pelo serviço foram divididas em áreas chamadas células. Cada célula capta a mensagem e a transfere diretamente para uma central de controle.

http://www.física.cdcc.usp.br.Acessadoem22/07/2013.Adaptado.

No que se refere à transmissão da informação no sistema nervoso, uma analogia entre a telefonia celular e o que ocorre no corpo humano:

a) É completamente válida, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais elétricos transmitidos por uma célula, sem intermediários, a uma central de controle.

b) É válida apenas em parte, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais elétricos que resultam em resposta imediata, sem atingir uma central de controle.

c) É válida apenas em parte, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais elétricos transferidos, célula a célula, até uma central de controle.

d) Não é válida, pois, no corpo humano, as informações do meio são captadas e transformadas em estímulos hormonais, transmitidos rapidamente a uma central de controle.

e) Não é válida, pois, no corpo humano, as informações do meio são captadas e transformadas em sinais químicos e elétricos, transferidos a vários pontos periféricos de controle.

15. (UEM) Acerca da propagação do impulso nervoso, assinale o que for correto.

I   II

0  0 – A “despolarização” de uma área da membrana causa alteração de permeabilidade da área vizinha à sua frente.

1  1 – O impulso nervoso nada mais é do que a propagação do potencial de ação ao longo do neurônio.

2  2 – O impulso nervoso é bidirecional em uma neurofibra.

3  3 – Nos dendritos, o impulso nervoso se propaga das extremidades dendríticas para o corpo celular, sendo chamado de celulípeto. No axônio, o impulso nervoso se propaga de sua junção com o corpo celular para a extremidade axônica, sendo chamado de celulífugo.

4  4 – Os estímulos são captados pelos dendritos ou pelo próprio corpo celular. Algumas vezes, até mesmo pelo axônio.

16. (IFNMG) A figura abaixo ilustra o mecanismo fisiológico de comunicação entre neurônios.

16

Fonte: http://www2.dq.fct.unl.pt/cadeiras/qpn1/proj/acetilcolina/sinapses.htm.

Acesso em: 22 out. 2014.

Em relação à sinapse axodendrítica evidenciada, pode-se afirmar que:

a) A membrana pós-sináptica sofrerá uma repolarização para desencadear um novo impulso nervoso.

b) Na fenda sináptica são liberados os neurotransmissores a partir de uma exocitose das vesículas sinápticas.

c) O impulso nervoso é bidirecional, podendo passar do axônio para o dendrito assim como do dendrito para o axônio.

d) O potencial de repouso gerado pela “despolarização” da membrana pré-sináptica é de + 40Mv.

17. (UFSC) Sobre biofísica de membranas, assinale a alternativa correta.

a) O influxo de sódio na célula é responsável pela fase de “despolarização” do potencial de ação de um neurônio.

b) Um neurotransmissor tem como ação imediata na membrana pós-sináptica um potencial de ação.

c) Os potenciais graduáveis são reservados às membranas das células musculares.

d) Na grande maioria das células, o potencial de repouso da membrana celular tem um valor mais próximo do potencial de equilíbrio eletroquímico do íon potássio e mais distante do potencial de equilíbrio eletroquímico do íon sódio.

e) A bomba de sódio/potássio compensa o excesso de sódio que entra nas células e o excesso de potássio que sai das células, transferindo esses íons através da membrana a favor de seus gradientes de concentração.

18. (FMJ) O gráfico mostra a formação de um potencial de ação em um neurônio.

18

Após aplicar um estímulo na célula nervosa, ocorre uma fase de “despolarização” e, em seguida, ocorre a fase de repolarização, retornando ao estado de “repouso”. A alteração de polaridade é conhecida como potencial de ação, que permite a propagação do impulso nervoso. Assim, de acordo com o gráfico, após ocorrer o estímulo, a despolarização consiste na:

a) Saída de íons sódio por transporte passivo.

b) Entrada de íons potássio por transporte ativo.

c) Saída de íons cloro por difusão.

d) Saída de íons potássio por transporte ativo.

e) Entrada de íons sódio por difusão.

19. Assinale a(s) alternativa(s) correta(s).

I   II

0   0 – Tomando como exemplo o axônio da fibra nervosa em repouso, é correto afirmar que os cátions mais abundantes fora e dentro da célula são, respectivamente, K+ e Na+.

1  1 – Excitabilidade é a capacidade da célula viva de responder às variações de energia (estímulos).

2  2 – Modificações elétricas e químicas que vão se propagando ao longo de uma fibra nervosa são conhecidas, genericamente, como polarização.

3  3 – O aumento da concentração extracelular de K+ e Na+ diminui a excitabilidade.

4 4 – A diminuição da concentração de Ca++ e Mg++ extracelular diminui o limiar de excitação.

20. (COVEST) Analise a figura abaixo, que mostra a variação do potencial da membrana durante a resposta “tudo ou nada” do neurônio a um estímulo eficaz.

20

I  II

0  0 – Na fase 1, a membrana celular apresenta uma maior permeabilidade ao K+, tornando o meio intracelular mais negativo em relação ao meio extracelular.

1  1 – Na fase 2, a célula apresenta uma inversão de sua polaridade, sendo o interior da célula positivo em relação ao meio extracelular.

2 2 – A fase 3 corresponde ao momento de repolarização do neurônio, sendo este incapaz de responder a outro estímulo; por isso, esse momento é chamado de período refratário absoluto.

3  3 – Na fase 4, ocorre a redistribuição de íons através da membrana, sendo que, ativamente, o sódio é retirado e, ao mesmo tempo, ocorre entrada de potássio.

4  4 – Na fase 5, a célula alcançou seu nível de repouso; nessa fase, é mais difícil obter-se uma resposta a qualquer estímulo.

gab

 

 

 

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE CITOLOGIA (3)

01. (IFSC) Durante uma aula de laboratório foram colocadas em frente a um aluno três fotografias de células. As fotografias foram obtidas por microscópio eletrônico de transmissão e havia uma lista de algumas estruturas identificadas para cada célula:

Célula 1: parede celular, mitocôndrias, plasmodesmas e vacúolo de suco celular ou central.

Célula 2: mesossoma, plasmídeo, parede celular e ribossomos.

Célula 3: glicocálix, mitocôndrias, ribossomos e lisossomos.

Considerando seus conhecimentos sobre biologia celular, assinale a soma da(s) proposição(ões) correta(s).

01. O plasmídeo corresponde a uma molécula circular de DNA existente em células procariontes, sendo assim o organismo representado pela célula 2 pertence a um organismo do reino Monera, que inclui, as bactérias e cianobactérias.

02. A presença de parede celular nas células 1 e 2 indica que as duas células pertencem a organismos vegetais.

04. Se considerarmos que o organismo representado pela célula 3 é multicelular e não apresenta parede celular, poderemos afirmar que se trata de um animal.

08. Todas as três células possuem ácidos nucleicos e sintetizam proteínas através dos processos de transcrição e tradução.

16. Se considerarmos que as mitocôndrias não existem na célula 2, poderemos então afirmar que esse organismo é fotossintetizante.

Soma das alternativas corretas:

02. (IFMG) Observando as células da epiderme humana, uma bactéria e a célula da epiderme da raiz de uma goiabeira, pode-se afirmar que todas possuem:

a) Membrana plasmática e mitocôndrias, porém só a bactéria possui parede celular.

b) Membrana plasmática e mitocôndrias, porém só a célula da epiderme da raiz de uma goiabeira possui parede celular.

c) DNA, membrana plasmática e ribossomos, porém só a célula da epiderme da raiz de uma goiabeira possui parede celular.

d) DNA, membrana plasmática e ribossomos, porém só a célula da epiderme humana não possui parede celular.

03. (PUC-CAMPINAS) Um estudante, ao comparar o Lêvedo de cerveja com algas verdes unicelulares, apresentou as seguintes conclusões:

I. Ambos são organismos autótrofos.

II. As células de ambos possuem núcleo com carioteca.

III. Em ambos ocorre o processo da glicólise.

IV. As células de ambos são circundadas por parede celular com a mesma constituição química.

O estudante acertou apenas nas conclusões:

a) I e II.

b) I e III.

c) I e IV.

d) II e III.

e) III e IV.

04. (UNEB) Bastante consumida no Brasil, a linguiça frescal está no barzinho da esquina e na mesa dos brasileiros. Mas a qualidade do produto varia de região para região, devido aos diferentes métodos de processamento empregados, principalmente se for preparado de modo artesanal, linguiça caseira. Nesta, os sais de cura, compostos adicionados a carnes com finalidade bactericida e também para dar-lhes cor e sabor atraentes, não conseguem controlar, mesmo sob refrigeração, a bactéria patogênica Staphylococcus aureus, comum em contaminações nesse tipo de alimento. Os níveis de sal de cura usados em linguiças, como o nitrito e o nitrato de sódio, são insuficientes para combater S. aureus. Mas, como ainda não se tem espécies químicas com ação bactericida igual ou superior à do nitrito, nesse tipo de produto para combater essa e outras bactérias, como a Salmonella, a espécie química ainda é empregada. A higiene passa a ser então, segundo o pesquisador, um item essencial para evitar que a linguiça caseira seja contaminada durante o processo de produção.

A ‘cura de carnes’ é um procedimento cujo fim é conservar a carne por um tempo maior a partir da adição de sais, açúcar, condimentos e compostos que fixam a cor, conferem aroma agradável e evitam contaminação. Entre esses, estão os nitratos e nitritos, que dão cor avermelhada ao alimento e funcionam como agente bacteriostático.

(PERIGO oculto, 2009, p. 60-61).

A respeito da organização celular característica dos organismos citados no texto, é correto afirmar:

01. Apresentam envoltório interno delimitando o material genético em um núcleo diferenciado.

02. Realizam síntese proteica exclusivamente em polissomos livres espalhados no citoplasma celular.

03. São seres anaeróbios obrigatórios devido à ausência de organelas do tipo mitocôndrias em seu ambiente citossólico celular.

04. Possuem maior virulência por causa da sua resistência a baixas temperaturas devido à presença de intensa área com retículos endoplasmáticos.

05. Os sais de cura são eficientes no controle bacteriano por interferir na síntese de esteroides nas cisternas do complexo golgiense bacteriano.

Soma das alternativas corretas:

05. Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas droga antimitóticas que inibem na progressão a partir dos pontos indicados.

05

Assinale a afirmativa incorreta.

a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular.

b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular.

c) Pelo menos duas das drogas interferem diretamente na síntese proteica.

d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo.

06. O caráter procariótico do sistema genético das mitocôndrias, bem como dos cloroplastos, sugere que essas organelas Originaram-se de bactérias endocitadas há mais de um bilhão de anos. De fato, evidencia-se uma grande semelhança entre o funcionamento e constituição dessas organelas e bactérias. São evidências da hipótese endossimbiôntica descrita acima, exceto:

a) Síntese proteica por ribossomos próprios das organelas.

b) Mitocôndrias e cloroplastos apresentam DNA e RNA.

c) Presença de duas membranas lipoproteicas nas organelas.

d) Sobrevivência autônoma das organelas isoladas da célula.

07. Os protozoários são organismos que em sua maioria habitam o ambiente aquático, entretanto, não apresentam parede celular. Eles apresentam como mecanismo para eliminar o excesso de água absorvido, em ambiente dulcícola, uma estrutura que permite a osmorregulação. Essa estrutura é conhecida como:

a) Vacúolos contráteis.

b) Pseudópodes

c) Membrana Plasmática

d) Flagelos

e) Cílios

08. (UFSC)

08

Fonte: AMABIS, JM e MARTHO, G. Biologia das Células. 1a ed.

São Paulo: Moderna, 2004, p. 130-132.

Em relação aos desenhos acima, é correto afirmar que:

01. O desenho A representa uma célula animal, o desenho B representa uma célula vegetal e o desenho C representa uma bactéria.

02. A seta 1 indica o local de produção de ATP; a seta 2 indica a organela responsável pela produção de enzimas digestivas e a seta 3 indica elementos responsáveis pela síntese de polipeptídeos.

04. A seta 4 indica o local de produção de proteínas, que poderão ser transportadas para o local indicado pela seta 5, estrutura responsável por liberar as proteínas no meio extracelular.

08. Apesar de sua diversidade, todas as células apresentam membrana plasmática, citoplasma, núcleo e carioteca.

16. Os ribossomos são elementos complexos que aparecem somente nas células eucariotas.

32. A membrana plasmática da célula animal é frágil e flexível, ao passo que a membrana plasmática da célula vegetal é espessa e rígida, devido à celulose.

64. A clorofila é um pigmento apresentado apenas por células vegetais.

Soma das alternativas corretas:

09. (UFTM) Os eritroblastos são células que apresentam núcleo e várias organelas membranosas. Durante a diferenciação celular, formam-se os eritrócitos (hemácias), que são anucleados e não possuem organelas. Ao longo desse processo, o núcleo é:

a) Eliminado por endocitose e os lisossomos realizam a heterofagia das organelas celulares, eliminando-as da célula.

b) Eliminado por clasmocitose e os peroxissomos realizam a autofagia, autodestruindo as organelas celulares.

c) Eliminado por exocitose e os lisossomos realizam a autofagia, processo que leva à destruição das organelas.

d) Destruído no interior da célula, juntamente com várias organelas, pelas enzimas contidas nos lisossomos.

e) Destruído no interior da célula pelas enzimas dos peroxissomos e as organelas são destruídas pelas enzimas lisossômicas.

10. O uso indiscriminado e incorreto de antibióticos para combater infecções tem contribuído para o “desenvolvimento” de genes mais resistentes a esses medicamentos. Esses genes ficam localizados:

a) No microplasma.

b) Nas enzimas de restrição.

c) Nos plasmídeos.

d) Nos pili.

e) No glicolipídeo.

11. (MACK) O esquema abaixo representa uma das teorias para a evolução celular. A esse respeito são feitas as seguintes afirmações:

11

I. O organismo 1 é semelhante às bactérias atuais.

II. A formação de dobras na membrana levou ao surgimento de estruturas como o retículo endoplasmático, o complexo de Golgi e a carioteca.

III. Uma das principais vantagens da ocorrência da formação das dobras na membrana é o aumento de superfície de contato entre o citoplasma e o meio.

Assinale:

a) Se somente as afirmativas I e III estiverem corretas.

b) Se somente as afirmativas II e III estiverem corretas.

c) Se todas as afirmativas estiverem corretas.

d) Se somente a afirmativa III estiver correta.

e) Se somente as afirmativas I e II estiverem corretas.

12. (UEL) Na década de 1950, a pesquisa biológica começou a empregar os microscópios eletrônicos, que possibilitaram o estudo detalhado da estrutura interna das células. Observe, na figura a seguir, a ilustração de uma célula vegetal e algumas imagens em micrografia eletrônica.

12

(Adaptado de: SADAVA, D. et all. Vida: A ciência da biologia. V. 1. 8 ed. Porto Alegre: Artmed. 2009. p. 77.)

Quanto às estruturas anteriormente relacionadas, é correto afirmar:

a) A imagem 1 é de uma organela onde as substâncias obtidas do ambiente externo são processadas, fornecendo energia para o metabolismo celular.

b) A imagem 2 é de uma organela na qual a energia da luz é convertida na energia química presente em ligações entre átomos, produzindo açúcares.

c) A imagem 3 é de uma organela que concentra, empacota e seleciona as proteínas antes de enviá-las para suas destinações celulares ou extracelulares.

d) A imagem 4 é de uma organela na qual a energia química potencial de moléculas combustíveis é convertida em uma forma de energia passível de uso pela célula.

e) A imagem 5 é de uma organela que produz diversos tipos de enzimas capazes de digerir grande variedade de substâncias orgânicas.

13. (UNESP) A figura apresenta os esquemas de duas células.

13

Porém, o ilustrador cometeu um engano ao identificar as estruturas celulares. É correto afirmar que:

a) II é uma célula vegetal e o engano está na identificação do complexo golgiense nesta célula, uma vez que este ocorre em células animais, mas não em células vegetais.

b) II é uma célula animal e o engano está na identificação do vacúolo em ambas as células, além de este ser característico de células vegetais, mas não de células animais.

c) II é uma célula animal e o engano está na identificação dos centríolos nesta célula, uma vez que estes são característicos de células vegetais, mas não de células animais.

d) I é uma célula animal e o engano está na identificação das mitocôndrias em ambas as células, além de estas ocorrerem em células animais, mas não em células vegetais.

e) I é uma célula vegetal e o engano está na identificação da membrana plasmática nesta célula, uma vez que esta ocorre em células animais, mas não em células vegetais.

14. (UNIFOR) Considere as seguintes afirmações sobre essa figura:

14

I. Representa uma célula bacteriana devido à presença de parede celular e plasmodesmos.

II. Mostra uma célula animal uma vez que possui complexo de Golgi, retículo endoplasmático e mitocôndrias.

III. Esquematiza uma célula vegetal já que apresenta parede celular, plasmodesmos, cloroplastos e vacúolos.

É compatível com a figura o que se afirma somente em:

a) I.

b) II.

c) III.

d) I e II.

e) I e III.

15. (PUC-RS) Em um experimento com ratos de laboratório, um biólogo constatou que o aumento de substâncias tóxicas na circulação induzia os hepatócitos a intensificarem a fabricação, empacotamento e exocitose de enzimas desintoxicantes a fim de neutralizar a toxicidade no organismo. Tal constatação se deveu a uma observação citológica dos referidos hepatócitos, nos quais foi possível detectar:

a) O aumento da área do retículo endoplasmático.

b) O aumento na divisão mitocondrial.

c) A diminuição do número de organelas.

d) A diminuição da quantidade de ribossomos.

e) A duplicação do nucléolo.

16. (UFU) No metabolismo célula, as mitocôndrias convertem glicose e oxigênio em energia. Como subproduto dessa reação, formam-se radicais de oxigênio (superóxido) que são convertidos, pela enzima superóxido dismutase (SOD), em peróxidos de hidrogênio. Considerando o processo metabólico acima apresentado, analise as afirmativas abaixo.

I. Os radicais de oxigênio são altamente reativos, podendo danificar o DNA dos cromossomos, o DNA mitocondrial e a membrana celular. Assim sendo, a SOD transforma esses radicais em peróxidos de hidrogênio, que é inócuo à célula.

II. O peróxido de hidrogênio é tóxico e mutagênico. Assim sendo, com ajuda da catalase, deve ser convertido em oxigênio molecular e água, que são substâncias inócuas para o meio celular.

III. Peroxissomos são vesículas celulares que contem enzimas que modificam substâncias tóxicas, tornando-se inofensivas para a célula.

Marque a alternativa correta.

a) I e II são corretas.

b) II e II são corretas.

c) I e III são corretas.

d) Apenas I é correta.

17. (COVEST) Na tabela abaixo, é mostrada a distribuição de algumas estruturas celulares em três tipos de células. Considerando essa distribuição, assinale a alternativa correta.

17

18. (UPE)  Leia o texto a seguir:

Várias são as formas de observação cromossômica óptica em gafanhotos, organismos modelo para o estudo de divisão celular, as quais incluem técnicas clássicas e diferenciais. A técnica clássica de esmagamento de folículos associada à coloração convencional permite visualizar a cromatina do núcleo interfásico, bem como o número e a morfologia cromossômica em fases da mitose e/ou meiose. As técnicas diferenciais podem ou não usar ferramentas moleculares e mostram detalhes da organização cromossômica. Uma técnica muito simples, conhecida como impregnação por nitrato de prata, permite visualizar os produtos remanescentes dos nucléolos ativos da interfase anterior.

Sobre a organela mencionada no texto, é correto afirmar que:

a) A aglomeração dinâmica de partículas ribossômicas em formação origina os nucléolos, que são massas densas delimitadas por membranas, ocorrendo sempre aos pares, e visualizadas por microscopia óptica ou eletrônica.

b) Ao ocorrer a espiralação cromossômica, os nucléolos desaparecem rapidamente e voltam a reaparecer no fim da divisão nuclear, portanto a melhor fase da meiose para se observarem nucléolos através da coloração convencional é a anáfase I.

c) Nucléolos são gerados nas regiões teloméricas de alguns cromossomos e podem ser evidenciados de forma direta por meio de coloração convencional, pois as ribonucleoproteínas produzidas não saem do núcleo.

d) Genes para ácido ribonucleico ribossômico (RNAr) são intensamente transcritos nas regiões organizadoras de nucléolos dos cromossomos, e seus produtos podem ser visualizados pelo nitrato de prata.

e) Nucléolos são regiões de intensa produção de ácido ribonucleico transportador (RNAt), principal componente dos ribossomos. Ao término da síntese, esse RNA associa‐se a proteínas originando as ribonucleoproteínas, visualizadas pelo nitrato de prata.

19. (COVEST) Células procariontes e eucariontes possuem tanto aspectos em comum quanto aspectos que as diferenciam. A figura abaixo representa esses tipos celulares indicando alguns de seus componentes. Em relação às características dessas células e aos aspectos indicados na figura, podemos afirmar o que segue.

19

I   II

0  0 – Tanto procariontes quanto eucariontes possuem o mecanismo replicativo/hereditário na forma de ácidos nucleicos.

1  1 – Células procariontes não possuem os ribossomos, que são necessários à produção de proteínas nas células eucariontes.

2  2  – Por possuírem parede celular, as células A e C são certamente procariontes.

3  3 – A célula A não possui material nuclear e, portanto, também não possui os genes, sendo assim uma célula procarionte.

4  4 – A célula A é procarionte, e as células B e C são eucariontes.

20. (FATEC) Considere as características das células A, B, C e D que estão representadas na tabela abaixo, relacionadas à presença (+) ou ausência (–) de alguns componentes.

20

São exemplos de organismos que possuem células do tipo A, B, C e D, respectivamente,

a) Paramécio, pinheiro, cogumelo e cobra.

b) Cianobactéria, fungo, ameba e minhoca.

c) Paramécio, musgo, bolor de pão e gato.

d) Cianobactéria, samambaia, champignon e paramécio.

e) Bactéria, líquen, bolor do mamão e mosquito.

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE GENÉTICA MOLECULAR (5)

01. (UNESP) Na segunda metade do século XIX, Mendel havia descoberto algumas regras básicas sobre herança, mas suas ideias passaram despercebidas. No início dos anos 1900, Walter Sutton e outros verificaram que o comportamento dos cromossomos na divisão celular correspondia ao descrito por Mendel para os fatores hereditários. O que faltava era comprovar a ligação entre esses dados. A descoberta que possibilitou isso foi:

a) As mutações genéticas estão correlacionadas às mudanças evolutivas, por Theodosius Dobzhansky.

b) É possível conhecer a exata localização de um gene no cromossomo, como demonstrado por Calvin Bridges.

c) Os raios X aumentam dramaticamente a taxa de mutações, por Hermann Müller.

d) O DNA tem uma conformação em dupla hélice, por James Watson e Francis Crick.

e) Os genes localizam-se em posições específicas do cromossomo, por Thomas Morgan.

02. (X Olimpíada Brasileira de BIOLOGIA)

O texto abaixo descreve bioquimicamente as diferenças observadas por Mendel quanto à forma da semente. Analise o texto e responda esta questão

• O alelo A que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases que codifica a enzima SBE-1 (starch-branching enzyme ou enzima ramificadora do amido).

• O alelo a que codifica a semente rugosa, é um fragmento de DNA com uma inserção de 800 pares de bases, portanto o gene possui 4,1 mil pares de bases e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, levando a um maior acumulo de água, e quando a semente seca torna-se rugosa.

Supondo que os fragmentos de DNA descritos correspondem a éxons (segmentos ativos) espera-se que as enzimas codificadas pelos genes A e a, contenham, respectivamente, o seguinte número aproximado de aminoácidos:

a) 1.100; 267.

b) 1.100; 4.100.

c) 2.200; 2734.

d) 9.900; 12.300.

e) 1100; 1367.

03. Os seres vivos são farinha do mesmo saco.

Analise as alternativas a seguir e assinale a que melhor justifica a seguinte frase:

a) Todos os seres vivos têm uma composição química semelhante: são feitos da mesma matéria.

b) Há no corpo centenas de trilhões de células controladas pelos DNAs.

c) No DNA está escrito até o jeito dos filhos que você pode vir a ter.

d) A duplicação do DNA significa a duplicação dos cromossomos, conduzindo à duplicação das células.

04. “Radioatividade após acidente de Fukushima causou mutação nas borboletas”

“Mutações genéticas foram detectadas em três gerações de borboletas nos arredores da central nuclear japonesa de Fukushima, informaram cientistas japoneses, o que aumenta os temores de que a radioatividade possa afetar outras espécies.”

                                                                                                                                                                                 Fonte: UOL Notícias Tecnologia.

O texto acima é um fragmento de uma notícia veiculada em agosto deste ano na mídia eletrônica. De acordo com os dados da notícia e seus conhecimentos sobre o assunto, assinale a alternativa correta:

a) Os cientistas japoneses concluíram que se até as borboletas, que são seres pequenos e frágeis, foram afetadas pela radioatividade, com certeza os seres humanos também foram.

b) Em Fukushima, a radioatividade atuou como agente mutagênico para as borboletas dos arredores da central nuclear, causando nelas alterações genéticas.

c) A radioatividade causou mutação nas borboletas da região próxima a Fukushima, pois as borboletas são seres que têm predisposição genética para esse tipo de erro.

d) A mutação, como a ocorrida nas borboletas, nada mais é do que uma diminuição do número de células do organismo.

e) O agente mutagênico, que nesse caso é a radioatividade, é uma substância capaz de multiplicar células normais nos organismos.

05. Sobre os ácidos nucleicos, são feitas as seguintes afirmações:

I. São macromoléculas de elevada massa molecular, que possuem ácido fosfórico, açúcares e bases púricas e pirimídicas em sua composição.

II. Ocorrem em todas as células vivas e são responsáveis pelo armazenamento e transmissão da informação genética e por sua tradução, que é expressa pela síntese proteica.

III. Encontram-se presentes no núcleo dos procariotos e dispersos no hialoplasma dos eucariotos.

IV. Encontram-se normalmente organizados sob a forma de fita simples ou dupla.

Das quatro afirmações anteriores, são verdadeiras:

a) Apenas a III e IV.

b) Apenas a III.

c) Apenas a I, II e IV.

d) Apenas a I e II.

e) Todas as afirmações são corretas.

06. (UNIOESTE) Com relação ao material genético, é correto afirmar que:

01. Cada RNA mensageiro possui, em determinada região de sua molécula, o anticódon.

02. O DNA apresenta, entre suas bases púricas, uracil e o RNA, timina.

04. Entre os cromossomos homólogos ocorre permuta gênica, o que garante a variabilidade genética.

08. As cadeias de RNA mensageiro são produtos da atividade ribossômica.

16. A alteração na seqüência de bases nitrogenadas de um segmento de DNA é uma mutação.

32. O DNA e o RNA, quanto à sua estrutura química, são polipeptídeos.

Soma das alternativas corretas:

07. O esquema abaixo representa um segmento de uma cadeia proteica e os anticódons correspondentes aos aminoácidos.

07

Os códons correspondentes ao cístron são:

a) ACC – CAT – TGA – ATA – GTG.

b) UGG – GUA – ACU – UAU – CAC.

c) TGG – CAT – GTG – ATT – UAU.

d) UGG – CAU – GUG – AUA – CAU.

e) TAT – GTA – ACT – TAT – CAC.

08. Com relação ao DNA, assinale a afirmativa incorreta.

a) As informações hereditárias são codificadas no DNA.

b) Graças à capacidade do DNA de autoduplicar-se, os gens podem manter suas características de uma geração a outra.

c) A molécula de DNA apresenta-se estruturalmente como uma dupla hélice.

d) O DNA é encontrado em grande quantidade no citoplasma e em pequenas quantidades no núcleo.

e) É um polinucleotídeo, sendo cada nucleotídeo formado de desoxirribose, fosfato e base nitrogenada, os quais se unem por meio do fosfato de um nucleotídeo com a pentose do outro.

09. (VUNESP) Um dos filamentos da dupla hélice de uma molécula de DNA tem a seguinte sequência: AACGATCGCTCA. Os seus produtos de duplicação e transcrição são, respectivamente:

a) AACGATCGCTCA; TTGCTAGCGAGT.

b) TTGCTAGCGAGT; UUGCUAGCGAGU.

c) UUCGUACGCACU; TTGCTAGCGAGT.

d) TTGCTAGCGAGT; AACGATCGCTCA.

e) TTCGTACGCACT; AACGATCGCTCA.

10. Com relação ao código genético assinale as afirmações corretas:

01. O código genético é universal, isto é, é o mesmo para todos os seres vivos.

02. Cada trinca de bases do DNA codifica sempre o mesmo aminoácido da cadeia polipeptídica.

04. Cada aminoácido pode ser codificado por mais de uma trinca de bases na cadeia do DNA.

08. O mesmo ribossomo, traduzindo diferentes moléculas de RNAm, dará origem a diferentes tipos de moléculas proteicas.

16. A mesma molécula de RNAm, sendo traduzida por diferentes ribossomos, dará origem a várias moléculas da mesma proteína.

Soma das alternativas corretas:

11. (IFMT) Genes saltadores no DNA humano

O genoma humano é constituído por cerca de 50% de elementos transponíveis DNA, os chamados “genes saltadores”. Alguns desses elementos saltadores saem de um local para se inserir em outro. Outros estão sendo copiados para novos locais, resultando em crescente número de inserções em todo o genoma humano. Seja qual for o mecanismo, todos os elementos transponíveis têm o potencial de afetar a mudança por meio de mutações, duplicações ou supressões. Baseando-se em seus conhecimentos da genética, marque a alternativa que melhor define o termo Genoma.

                                                                                                  (dnaeoutrascoisas.blogspot.com/).

a) Estrutura microscópica constituída pela molécula de DNA.

b) Alelo que só determina o caráter quando ocorre em dose dupla.

c) Aspecto do indivíduo determinado pela expressão das características genéticas.

d) Conjunto dos genes existentes em todos os cromossomas de uma espécie.

e) Segmento do DNA com informações para a síntese de uma proteína.

12. (UEM) Sobre a estrutura e a função dos genes, assinale o que for correto.

01. Os métodos para identificação individual de pessoas pelo DNA, como os testes de paternidade ou de identificação de criminosos e de vítimas, baseiam-se no fato de todos os indivíduos, com exceção dos gêmeos idênticos, apresentarem diferenças nas suas sequências de bases nitrogenadas.

02. Os genes que codificam proteínas exercem sua função com uma de suas fitas servindo de molde para a síntese de RNA mensageiro.

04. Entre todos os tipos de RNA produzidos pela célula, o RNA mensageiro é o único que é sintetizado tendo como molde uma sequência de bases do DNA.

08. Duas moléculas de DNA dupla-hélice com a mesma sequência de bases têm, necessariamente, a mesma proporção de bases.

16. Durante a síntese de proteínas, cada trinca de bases do RNA mensageiro, denominada códon, especifica uma trinca de aminoácidos na tradução.

32. Os arranjos com repetição dos quatro tipos de bases nitrogenadas do RNA mensageiro (Adenina, Guanina, Citosina e Uracila), tomadas três a três, correspondem aos 64 códons de três letras do código genético. Se o RNA mensageiro fosse formado por cinco tipos de bases, seriam possíveis 128 códons de três letras.

64. O mesmo código genético é válido para os genes dos cromossomos dos coelhos e para os genes dos cromossomos da alface.

Soma das alternativas corretas:

13. (IFSul) Em 1962, o premio Nobel de Fisiologia e Medicina foi concedido aos cientistas Francis Crick, Maurice Wilkins (britânicos) e James Watson (norte-americano) por suas pesquisas que determinaram a estrutura molecular do DNA. Sobre o DNA, são feitas as seguintes afirmativas:

I. Possui estrutura em dupla hélice, encontrada no núcleo celular, e sua importância reside no fato de que ele carrega os genes.

II. No emparelhamento das fitas de DNA; se em uma fita tivermos a sequencia de bases AATTTCG, na outra teremos TTAAAGC.

III. É formado por uma pentose denominada desoxirribose e pelas bases nitrogenadas adenina, timina, citosina, guanina e uracila.

IV. Em alguns vírus, são encontrados ácidos nucleicos do tipo DNA espalhados no citoplasma viral.

Estão corretas apenas as afirmativas:

a) I e II.

b) I, II e III.

c) III e IV.

d) I, III e IV.

14. (UERJ) As características abaixo são referentes aos processos de replicação, transcrição e tradução, que ocorrem em seres vivos.

I. A síntese de proteínas tem início antes mesmo do término da transcrição.

II. A grande maioria dos genes contém íntrons, retirados antes da tradução.

III. A síntese de proteínas sempre ocorre em ribossomos livres no citoplasma.

IV. O processo de replicação possui uma única origem.

As características I, II, III e IV estão associadas, respectivamente, aos organismos indicados em:

a) Eucariotos – eucariotos – procariotos – eucariotos.

b) Eucariotos – procariotos – eucariotos – procariotos.

c) Procariotos – eucariotos – procariotos – procariotos.

d) Procariotos – procariotos – eucariotos – procariotos.

15. (IFSuldeMinas) Leia o texto abaixo:

“Carta sobre descoberta de DNA vendida por 4 milhões de euros: em 1953, Francis Crick dirigiu uma carta ao seu filho de 12 anos para comunicar a descoberta da estrutura DNA, já retratada por Wilkins e Franklin por difração de raios-X. A carta foi vendida num leilão, em Nova Iorque, por 4 milhões de euros. Há 60 anos, Crick enviou esta missiva de sete páginas onde explicava o que era o ácido desoxirribonucleico (DNA) e enumerava as quatro bases que o componham, descoberta feita com o seu colega James Watson, ambos ganhadores do Prémio Nobel. Uma frase da carta diz: “cremos ter descoberto o mecanismo básico de cópia pelo qual a vida surge da vida. Como deves imaginar, estamos muito emocionados”.

                        Fonte: http://www.cienciahoje.pt/index.php?oid=57442&op=all. Acesso em 11 de Abril de 2013

A partir dos seus conhecimentos e tendo por base a descoberta abordada no texto apresentado, assinale a alternativa correta.

a) O DNA é composto por quatro bases nitrogenadas, que apresentam proporções iguais entre si.

b) As bases nitrogenadas do DNA são: A (adenina), U (uracila), G (guanina) e C (citosina).

c) Após essa descoberta, foi confirmada a previsão de muitos cientistas, que atribuíam às proteínas a portabilidade dos fatores genéticos.

d) O modelo proposto por Crick e Watson retratava uma estrutura tridimensional do DNA, na qual duas cadeias helicoidais se enrolavam em torno do mesmo eixo.

16. (UNIPAC) Na abertura da novela O Clone, aparece estilizada uma molécula de DNA. Abaixo, esquematizamos a molécula segundo o modelo proposto por James Watson e Francis Crick. Observe:

16

Assinale a alternativa incorreta, referente à molécula:

a) Em células eucariotas, o DNA está combinado com proteínas e organizado em fibras de cromatina no núcleo.

b) O DNA é constituído de milhares de ribonucleotídeos ligados à estrutura (a) através de pontes de hidrogênio.

c) O DNA armazena todas as informações genéticas necessárias para especificar a estrutura de proteínas.

d) Transcrição é a propriedade do DNA de servir de molde para gerar moléculas de RNAs.

e) No desenho acima, (b) e (c) representam, respectivamente, citosina e guanina.

17. (UFT) A figura a seguir representa uma dupla fita de DNA, com as seguintes características definidas: polaridades (5’ e 3’), ponto origem de replicação (Ori), direções de abertura das fitas e de síntese das novas cadeias de DNA (setas). Os fragmentos designados por A, B, C e D são as fitas moldes para o processo replicativo.

17

Com relação à replicação contínua e descontínua, marque a alternativa correta:

a) A replicação será contínua para os fragmentos A e C e descontínua para os fragmentos B e D.

b) A replicação será contínua para os fragmentos A e B e descontínua para os fragmentos C e D.

c) A replicação será contínua para os fragmentos B e D e descontínua para os fragmentos A e C.

d) A replicação será contínua para os fragmentos B e C e descontínua para os fragmentos A e D.

e) A replicação será contínua para os fragmentos A e D e descontínua para os fragmentos B e C.

18. (UECE) A anemia falciforme decorre de uma mutação específica no gene da beta-globina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGC

CCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG

GCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAA

GGAGACCAATAGAAACTGGGCATGT

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGC

CCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG

GCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAA

GGAGACCAATAGAAACTGGGCATGT

Para a tradução desses genes, é (são) necessário(s):

a) Somente o mRNA.

b) A fita complementar do DNA e o mRNA.

c) Somente o mRNA e o rRNA.

d) DNA, mRNA; tRNA e rRNA.

19. (UFV) A sequência dos cinco primeiros aminoácidos (aa), de um peptídeo em início de síntese, está representada abaixo. Na tabela, aparecem também representados alguns RNAs transportadores (tRNA) e seus respectivos aminoácidos.

19a

19b

Assinale a alternativa que contém o mRNA que traduziu a sequência de aminoácidos para formar o peptídeo:

a) 5 -AUG-CUC-CCC-CAA-GCA- 3.

b) 5 -CCC-CAA-GCA-CUC-AUG- 3.

c) 5 -CAA-GCA-GAG-UAC-CCC- 3.

d) 5 -GCA-CUC-GUU-AUG-CAA- 3.

e) 5 -UAC-GAG-GGG-GUU-CGU- 3.

20. (UEMG) Em 1940 os biólogos George Beadle e Eward Tatum anunciaram:

20

Esse anúncio indica que os biólogos descobriram:

a) A estrutura da molécula de DNA.

b) A sequência de bases do DNA.

c) O mecanismo de transcrição do código genético.

d) O papel biológico do Gene.

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE BOTÂNICA (VIII)

01. (UNICENTRO) Leia a afirmativa a seguir.

A geração duradoura da samambaia é o ______-que possui ______ formados por células ______, as quais sofrem divisão ______xe produzem ______xxque são células ______xque, uma vez em condições adequadas de umidade, germinam, dando origem a uma estrutura denominada ______xque é a geração efêmera da samambaia.

Com relação ao ciclo reprodutivo das samambaias, assinale a alternativa que apresenta, correta e respectivamente, os termos que preenchem as lacunas dessa afirmativa.

a) esporófito, esporângios, diploides, meiótica, esporos, haploides, gametófito.

b) esporófito, esporângios, diploides, mitótica, esporos, diploides, gametófito.

c) esporófito, esporângios, haploides, mitótica, esporos, diploides, gametófito.

d) gametófito, gametângios, haploides, mitótica, gametas, haploides, esporófito.

e) gametófito, gametângios, diploides, meiótica, gametas, haploides, esporófito.

02. (FAMERP) Analise os gráficos relativos ao cultivo de mudas da palmeira carnaúba hospedeira, Copernicia hospita, em dois ambientes diferentes, no estado do Ceará. Considere que as plantas estão submetidas às mesmas condições de luminosidade e irrigação ideais.

02

A análise dos dados permite concluir que as mudas cultivadas:

a) Na casa de vegetação apresentam menor taxa fotossintética.

b) A pleno Sol absorvem mais água do solo.

c) Na casa de vegetação perdem mais água por transpiração foliar.

d) A pleno Sol fecham seus estômatos em torno do meio-dia.

e) Na casa de vegetação transportam maior quantidade de seiva bruta pelo xilema.

03. (UFRN) Pode-se observar na figura o aprisionamento de um inseto, pelas folhas articuladas da espécie de planta carnívora do gênero Dionaea.

03

(Disponível em: http://arquivosreporter.blogspot.com.br/2013/11/armadilha-da-natureza.html.)

Esse movimento, em resposta do toque feito pelo animal, é um exemplo de:

a) Tropismo.

b) Nastismo.

c) Geotropismo.

d) Tigmotropismo.

04. (UPE) Subir a Ilha de Trindade é voltar ao tempo. Distante aproximadamente 1.200 km do Estado do Espírito Santo, possui uma flora bastante peculiar, que, em formação, se assemelha às primeiras florestas do planeta. Dominada por uma espécie endêmica, conhecida como Cyathea copelandii, tem porte baixo, cujo tecido lenhoso, denominado caudex, é formado externamente por pecíolos endurecidos das frondes antigas, revestindo o rizoma. A base do caudex está geralmente na horizontal, mas, a partir da metade em diante, a planta é ereta. As folhas divididas em folíolos surgem enroladas, e sua reprodução é sexuada. Por causa da introdução de cabritos na ilha, a espécie quase desapareceu. Depois da retirada dos animais, hoje é possível perceber uma leve recuperação (foto), com algumas árvores adultas e prótalos colonizando o solo desnudo e aumentando, na ilha, a área dessa floresta típica.

04

(Disponível em: casopis.vesmir.cz/files/obr/id/4092/type.html)

Essas características permitem classificar Cyathea copelandii em

a) Criptógama vascular e Pteridófita.

b) Criptógama avascular e Briófita.

c) Fanerógama angiosperma e Dicotiledônea.

d) Fanerógama gimnosperma e Conífera.

e) Fanerógama angiosperma e Monocotiledônea.

05. (CEFET-MG) Sobre os órgãos vegetais e suas funções, é incorreto afirmar que determinadas(os):

a) Caules efetuam as trocas gasosas.

b) Folhas realizam reprodução assexuada.
c) Raízes desempenham o papel de fixação.

d) frutos executam o processo de fecundação.

06. (UEPG) A fisiologia vegetal aborda questões dos fatores ambientais na nutrição da planta; o sistema de transporte de seiva; como os hormônios vegetais comandam as reações da planta; a fisiologia do crescimento e Desenvolvimento, entre outros. Na fisiologia das angiospermas, assinale o que for correto.

01. Segundo a teoria da coesão-tensão, também conhecida como teoria de Dixon, a seiva bruta é puxada desde as raízes até as folhas, devido fundamentalmente à transpiração das folhas. As células das folhas, ao perderem água por evaporação, têm sua pressão osmótica aumentada e retiram água das células vizinhas, que por sua vez, terminam por retirar água das terminações dos vasos xilemáticos.

02. Quando o solo está encharcado e a umidade do ar é elevada, as células-guarda do estômato absorvem água e o ostíolo se fecha.

04. A falta do nitrogênio limita drasticamente o crescimento das plantas. Embora seja o elemento químico mais abundante da atmosfera, as plantas não conseguem utilizar diretamente o gás N2 atmosférico.

08. O CO2 necessário à fotossíntese é absorvido pela planta pelos traqueídes dos elementos de vaso.

16. O ponto de saturação luminosa da fotossíntese ocorre quando a planta está em condições precárias de temperatura e CO2.

Soma das alternativas corretas:

07. (CEFET-MG) Analise a imagem seguinte que mostra um vaso de planta submetida à iluminação difusa que tombou, sem prejudicá-la, permanecendo por alguns dias nessa posição.

07

Disponível em: <http://getting-in.com/&gt;. Acesso em 14 abr 2014.

Nessas condições, a mudança de orientação da planta, explica-se pela (o):

a) Movimento do caule em direção à fonte de luz.

b) Crescimento da porção aérea contra a gravidade.

c) Curvatura normal do caule dessa espécie de planta.

d) Tentativa de estabelecimento do equilíbrio estático pela planta.

e) Orientação paralela dos ramos dessa espécie em relação ao solo.

08. (UPF) Na reprodução dos vegetais com sementes, ocorre a denominada dupla fecundação. Isso significa que:

a) As células envolvidas na reprodução dividem-se duas vezes consecutivamente, para formarem o embrião diploide.

b) Um dos núcleos espermáticos se junta ao núcleo da oosfera e forma o embrião (2n); o outro núcleo espermático funde-se aos dois núcleos polares, resultando no endosperma (3n).

c) Cada núcleo espermático sofre duas divisões e cada uma das quatro células resultantes fecundará uma célula da oosfera.

d) O núcleo da oosfera é fecundado por dois núcleos espermáticos do pólen.

e) Um dos núcleos espermáticos, ao juntar-se ao núcleo da oosfera, forma um embrião (3n), enquanto o outro se junta a um dos núcleos polares e dá origem ao endosperma (2n).

09. (UEM) Sobre a absorção de água e de sais minerais e sobre o mecanismo de transporte da seiva bruta e elaborada nos vegetais, assinale a(s) alternativa(s) correta(s).

01. De acordo com a teoria da coesão-tensão, os processos de absorção e de condução da seiva bruta estão relacionados com a transpiração.

02. A pressão positiva da raiz é responsável pela condução da água e dos sais minerais até as folhas das árvores de grande porte.

04. A seiva elaborada é conduzida das folhas para as diversas partes da planta pelos elementos crivados, ou vasos liberianos do floema.

08. O fluxo da seiva orgânica dentro do corpo vegetal ocorre dos órgãos de alta pressão osmótica para os de baixa pressão osmótica.

16. Retirando-se um anel completo ao redor do caule de uma planta, em uma profundidade que vai até o câmbio vascular, a mesma irá morrer por falta de água para realização da fotossíntese.

Soma das alternativas corretas:

10. (UERN) No ciclo de vida das pteridófitas, os esporos liberados atingem o solo e podem desenvolver os gametângios, também conhecidos como prótalos. No mesmo individuo, os prótalos diferenciam-se em masculinos e femininos sendo, portanto, hermafrodita. A figura representa o prótalo e suas estruturas. Observe.

10

Assinale a afirmativa correta.

a) Os arquegônios (II) produzem as oosferas – gametas femininos.

b) Os arquegônios (I) produzem os anterozoides – gametas masculinos.

c) Na posição II estão os anterídios, que produzem os anterozoides – gametas masculinos.

d) Os anterídios estão na posição I, o arquegônio na posição II e os rizoides na posição III.

11. (FURG-RS) Dicotiledôneas e monocotiledôneas são duas classes de angiospermas. O que caracteriza as monocotiledôneas é:

a) Raiz fasciculada, folhas paralelinérveas, flores geralmente trímeras, fruto com um cotilédone.

b) Raiz fasciculada, folhas paralelinérveas, flores geralmente pentâmeras, sementes com dois cotilédones.

c) Raiz fasciculada, folhas peninérveas, flores geralmente tetrâmeras, fruto com um cotilédone.

d) Raiz axial, folhas peninérveas, flores somente pentâmeras, fruto com um cotilédone.

e) Raiz axial, folhas peninérveas, flores tetrâmeras e pentâmeras, sementes com dois cotilédones.

12. (UNEMAT) A professora Celice Alexandre, da UNEMAT de Tangará da Serra, publicou recentemente, em parceria com Ana Kelly Koch, um livro sobre as orquídeas de Mato Grosso. Esse exuberante grupo de monocotiledôneas é um dos mais diversificados entre os vegetais. Sobre as orquídeas, marque a alternativa correta:

a) Orquídeas são epífitas, ou seja, parasitas de outras plantas sobre as quais elas vivem.

b) Outras monocotiledôneas são as gramíneas, as palmeiras e os pinheiros.

c) A raiz das orquídeas é do tipo pivotante ou axial.

d) No ciclo de vida vegetal, as orquídeas representam a fase haploide.

e) A competição por luz é um dos fatores que explica o porquê de muitas orquídeas serem epífitas.

13. (UniEvangélica) Observe a figura a seguir.

13

Disponível em: <http://www.educador.brasilescola.com&gt;. Acesso em 04 out. 2012.

Na germinação de uma semente de dicotiledônea, podemos notar que inicialmente aparecem duas pequenas pontas, em posições opostas. Uma delas, que cresce voltada para baixo, é a primeira raiz; a outra, voltada para cima, é o caule, em cuja extremidade são visíveis as duas primeiras folhas (cotilédones) que envolvem o botão ou gema apical.

CAMPBELL, Neil et al. Biologia. 8. ed. Porto Alegre: Artmed, 2010. p. 809.

Considerando o crescimento da planta, geotropismo positivo e geotropismo negativo podem ser relacionados, respectivamente:

a) Ao crescimento da raiz, que cresce voltada para baixo; e ao crescimento do caule, que cresce voltado para cima.

b) Ao crescimento do caule, que cresce voltado para cima; e ao crescimento da raiz, que cresce voltada para baixo.

c) Ao crescimento normal do caule em direção à luz; e ao crescimento anormal do caule.

d) Ao crescimento normal da raiz em direção à fonte de água no subsolo; e ao crescimento inadequado da raiz por não encontrar água no subsolo.

14. (UFJF) O milho, o arroz e o trigo figuram entre as principais espécies vegetais de interesse econômico utilizadas na alimentação humana e animal. Essas espécies vegetais apresentam, em comum, os seguintes caracteres foliares:

a) Folhas peninérveas, simples e pecioladas.

b) Folhas paralelinérveas, compostas e pecioladas.

c) Folhas peninérveas, compostas e invaginantes.

d) Folhas paralelinérveas, simples e invaginantes.

15. (UFRRJ) O ciclo reprodutivo representado a seguir é de:

15

a) Talófita.

b) Gimnosperma.

c) Pteridófita.

d) Briófita.

e) Angiosperma.

16. (PUC-RS) A floresta ombrófila mista, também conhecida como mata-de-araucária, ocorre em áreas de altitude do planalto meridional do Brasil. Como elementos característicos, encontram-se o pinheiro-brasileiro (Araucaria angustifolia), de onde se obtém o pinhão, e a samambaiaçu (Dicksonia selowiana), de onde se extraía o xaxim para a confecção de vasos para plantas. Segundo a classificação tradicional dos seres vivos, o pinheiro-brasileiro e a samambaiaçu são, respectivamente,

a) Angiosperma e Gimnosperma.

b) Angiosperma e Pteridófita.

c) Gimnosperma e Briófita.

d) Gimnosperma e Pteridófita.

e) Pteridófita e Gimnosperma.

17. (PUC-MG) A presença de diversos tipos de pelos nos vegetais lhes proporciona uma melhor adaptação ao meio ambiente. São processos relacionados com a presença de pelos vegetais, exceto:

a) Proteger contra ataques de animais.

b) Facilidade de dispersão de frutos e sementes.

c) Aumento no poder de absorção de água e sais.

d) Facilitar a perda de água em excesso, acumulada nos parênquimas.

18. (UFLA) O esquema abaixo representa um corte histológico de uma folha em vista lateral:

18

As funções das estruturas indicadas no esquema em 1, 2, 3 e 4 são:

a) 1 – Proteção; 2 – transpiração; 3 – circulação; 4 – fotossíntese.

b) 1 – Proteção; 2 – fotossíntese; 3 – circulação; 4 – trocas gasosas.

c) 1 – Trocas gasosas; 2 – proteção; 3 – fotossíntese; 4 – circulação.

d) 1 – Fotossíntese; 2 – proteção; 3 – trocas gasosas; 4 – transpiração.

19. (URCA) A principal estrutura de dispersão de propágulos entre os vegetais é o fruto. Sobre essa estrutura das angiospermas é incorreto:

a) Tem origem a partir do ovário da flor.

b) A semente está envolvida pelo endocarpo, geralmente.

c) A azeitona é um exemplo de drupa.

d) O abacate é um exemplo de baga.

e) A castanha é o fruto do cajueiro.

20. (UNIOESTE) É muito frequente desenvolverem-se algumas partes da flor que se tornam carnosas, em substituição ao ovário, e são denominadas pseudofrutos. Neste caso, o ovário com as sementes, embora reduzido, vai originar o verdadeiro fruto, que, em geral, não é comestível. Assinale a alternativa que possui apenas exemplos de pseudofrutos múltiplos.

a) Caju (Anarcadium ), maçã (Malus spp.), morango (Fragaria spp.).

b) Morango (Fragaria ), amora (Rubus spp.), figo (Ficus spp.).

c) Figo (Ficus ), abacaxi (Ananas spp.), caju (Anarcadium spp.).

d) Amora (Rubus ), figo (Ficus spp.), abacaxi (Ananas spp.).

e) Amora (Rubus ), maçã (Malus spp.), morango (Fragaria spp.).

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE BIOTECNOLOGIA (IV)

01. (UPE) Antigamente, seria impensável um híbrido de tal natureza, a não ser no nosso imaginário. Com o avanço das novas tecnologias, é possível combinar partes do genoma de qualquer ser vivo com outro de reinos iguais ou diferentes.

01

                Disponível em: http://ultimaquimera.com.br/category/charges. Adaptado.

Qual dos exemplos a seguir retrata um caso de transgenia?

a) Cabra com gene de hormônio de crescimento humano.

b) Cruzamento de jumento com égua resultando em uma mula.

c) Serpente com gene para toxina hemorrágica de peçonha.

d) Uma gema ou borbulha de tangerina inserida em um porta-enxerto de limão cravo.

e) Videira de uva com semente, com gene de suscetibilidade à virose do enrolamento da folha.

02. (UFT) É correto afirmar que a obtenção de organismos transgênicos se deve à:

a) Degeneração do código genético.

b) Estrutura do DNA de fita dupla.

c) Informação genética contida no DNA.

d) Universalidade do código genético.

03. (PUC-MG) Assinale a afirmativa incorreta.

a) A ativação do duplo processo de imunização depende de células do sistema imune denominadas linfócitos.

b) O resultado do processo de vacinação é a produção de anticorpos que reconhecem as partículas antigênicas.

c) O processo de inserção de um gene do protozoário no material genético do vírus é denominado de clonagem genômica.

d) O interesse em desenvolver uma vacina contra o mal de Chagas se deve ao fato de essa doença ainda constituir em problema de saúde pública, causado pela domiciliação dos vetores, provocada pela desagregação ambiental.

04. (UFRN) Como fazer um salmão comum virar um gigante? O segredo é pegar do Chinook (Salmão originário da Europa) um trecho de DNA denominado promotor do hormônio de crescimento e inseri-lo na célula ovo do salmão do Atlântico Norte. A sequência promotora controla, indiretamente, a produção de proteína que, nesse caso, é a do hormônio de crescimento. Enquanto o salmão oceânico só produz o hormônio do crescimento no verão, o híbrido produz o ano inteiro. Depois da inserção do DNA do Chinook no salmão do Atlântico Norte, este passa a ser:

a) Quimera, pois ocorreu a clivagem dos dois alelos do gene que codifica a produção do hormônio do crescimento.

b) Clone, pois esse organismo foi gerado artificialmente a partir de óvulos não fecundados, conferindo-lhe vantagens quanto ao seu desenvolvimento.

c) Animal transgênico, pois se trata de um organismo que contém materiais genéticos de outro ser vivo, com vantagens em relação ao seu tamanho.

d) Organismo geneticamente modificado, pois a inserção do DNA promotor do hormônio do crescimento produz cópias idênticas do salmão gigante.

05. (UEA) Com o desenvolvimento da biotecnologia, a ciência é capaz de produzir, por meio das bactérias, moléculas idênticas às humanas, utilizadas como medicamentos. A insulina e o hormônio do crescimento já são produzidos, por exemplo, por essa técnica. Tal procedimento é conhecido como tecnologia do DNA recombinante. A figura representa uma bactéria e suas principais estruturas.

05

A manipulação genética desse organismo para a produção de transgênicos ocorre por:

a) Inserção de genes humanos no plasmídeo.

b) Transferência de cromossomos humanos para o citoplasma.

c) Ativação do DNA recombinante por meio das proteínas da membrana.

d) Inoculação de fragmentos de RNAm no nucleoide.

e) Mapeamento do ácido nucleico dos ribossomos.

06. (UEG) Os organismos transgênicos são produzidos pela transferência de um gene de interesse, contido em um fragmento de DNA, para o zigoto de um organismo-alvo. As moléculas que cortam o fragmento de DNA em pontos específicos são:

a) Agentes químicos que atuam em pH extremo.

b) Catalisadores denominados enzima de restrição.

c) Polimerizadores termoestáveis de nucleotídeos.

d) Solventes orgânicos desnaturantes de DNA.

07. (UPE) Para responder esta questão, leia o texto a seguir:

O jumento não é mais o mesmo. Animal rústico e com fama de teimoso, a espécie está cada vez mais valorizada. Alguns animais recebem tratamento de primeira linha, com direito à transferência de embriões, inseminação artificial e congelamento de sêmen. Um bom jumento reprodutor, da raça pêga, vale até R$ 20 mil. O criador de asininos, Osmar Russo (Lorena, SP), diz que o mercado nunca esteve tão bom. “A maioria dos jumentos é vendida para produzir muares (burros e mulas). Um bom reprodutor precisa ter orelha bonita e grande, ser marchador, forte, resistente e manso. Mas o principal é imprimir as características às crias. Separo os melhores animais e cruzo com matrizes boas também. Meus animais nem se comparam aos de antigamente. Algumas jumentas, que mediam em torno de 1,3 metro, agora chegam a 1,4 metro.” Antigamente usavam-se os piores animais para obter muares. Hoje, os cruzamentos são com éguas das raças manga-larga, mangalarga marchador e campolina.

Disponível em: http://www.estadao.com.br/noticias/suplementos (Adaptado)

De acordo com os dados do texto, o processo que consiste em selecionar, alterar  geneticamente e aprimorar a qualidade dos jumentos, de modo a atender as necessidades humanas, é conhecido como:

a) Autofecundação.

b) Clonagem molecular.

c) Endogamia.

d) Melhoramento genético.

e) Terapia gênica.

08. (UEM) Sobre a eletroforese de DNA, é correto afirmar que:

01. É realizada utilizando-se uma placa com gel especial, fragmentos de DNA e aplicação de corrente elétrica.

02. Os fragmentos de DNA que possuem cargas negativas se deslocam para o polo positivo, quando é aplicada uma descarga elétrica na placa de gel.

04. A eletroforese de DNA tem sido utilizada para a identificação de pessoas, nas investigações policiais, em processos judiciais e na determinação da paternidade.

08. Gêmeos monozigóticos podem ser distinguidos pela análise do DNA nuclear.

16. Os fragmentos separados por eletroforese são formados por DNA com cadeia dupla.

Soma das alternativas corretas:

09. (UCPel) A engenharia genética é considerada como uma extensão dos cruzamentos seletivos, pois ambas tecnologias juntam o material de diferentes origens para criar organismos que possuem novas características. Com relação à engenharia genética, pode-se afirmar o seguinte:

I. A transferência do gene de um organismo para outro ocorre através de um pequeno fragmento de DNA chamado vetor, que pode ser um plasmídeo ou um vírus.

II. A possibilidade de transferência de genes é ilimitada entre organismos de diferentes espécies.

III. Nesta tecnologia, faz-se a transferência de um gene conhecido.

IV. O vetor utilizado deve conter uma origem de replicação, o que permite sua duplicação no hospedeiro.

V. Uma das aplicações da engenharia genética é a produção de insulina.

Considerando as afirmativas anteriores, assinale a opção correta.

a) Todas as afirmativas estão incorretas.

b) Estão corretas somente as afirmativas II e V.

c) Está correta somente a afirmativa I.

d) Todas as afirmativas estão corretas.

e) Estão corretas somente as afirmativas II, IV e V.

10. (UFSJ)   Leia o texto abaixo.

“Os impactos dos organismos geneticamente modificados abordados sob as dimensões agronômica, ecológica, cultural, social e política no livro “Transgênicos para quem? Agricultura, Ciência, Sociedade” estão na obra que será lançada no próximo dia 28, durante o Fórum Social Temático 2012, em Porto Alegre(RS). A publicação, que reúne artigos de diversos pesquisadores brasileiros e franceses, foi organizada por Magda Zanoni, bióloga, socióloga e pesquisadora do laboratório Dynamiques Sociales et Recomposition des Espaces (Centro Nacional de Pesquisa Científica – CNRS, França); e por Gilles Ferment, mestre em ecologia e gestão ambiental, e consultor do Núcleo de Estudos Agrários e Desenvolvimento Rural do Ministério do Desenvolvimento Agrário (NEAD/MDA). […]

“Transgênicos para quem?” é apresentado em três partes. A primeira aborda as incertezas científicas inerentes ao uso das biotecnologias modernas de reprogramação dos seres vivos e seus possíveis efeitos nocivos ao meio ambiente e à saúde humana. A segunda parte, “Transgênicos: O necessário enfoque multidisciplinar” se divide em mais três temas que discutem os embates agronômicos, ecológicos, políticos, institucionais, jurídicos, econômicos e sociais dos transgênicos. A última, “Atores sociais: resistências e cidadania”, discute o papel da sociedade civil no debate do uso dos transgênicos.

A publicação oferece uma diversidade de análises, destaca pontos de vista de agricultores familiares, cientistas internacionalmente conhecidos, estudantes, associações, cooperados e ativistas. O objetivo, segundo os organizadores, é trazer uma reflexão sobre a capacidade dos transgênicos de resolver as dificuldades atuais e futuras com as quais a sociedade e os agricultores familiares estão confrontados.

Transgênicos para quem? Integra a coleção NEAD.

Debate está disponível para download gratuito no Portal NEAD. Notícia publicada no site do Ministério do Desenvolvimento Agrário

Disponível em: (http://www.mda.gov.br/portal/noticias/item?item_id=9190597) Acesso em 18/jan./2012.

Sobre o interesse tecnológico na biologia molecular e suas técnicas, e na produção dos Organismos Geneticamente Modificados, (OGMs), é incorreto afirma que:

a) Os OGMs são organismos produzidos em laboratório com finalidades diversas, desde a produção de alimentos, medicamentos e para pesquisas científicas.

b) O interesse na produção agrícola de OGMs é a produção de vegetais mais sadios e resistentes a doenças.

c) A biotecnologia tem produzido OGMs com potencial risco à população e não há qualquer regulamentação no Brasil que controle seu cultivo, pesquisa e consumo.

d) O interesse nos OGMs é pelo uso da maquinaria genética das células para que elas produzam proteínas de interesse na agricultura, saúde, etc.

11. (UFU) A Escherichia coli  é o microrganismo mais estudado por cientistas no mundo todo, não somente pela importância de seu combate pelos órgãos promotores da saúde pública, devido às doenças intestinais causadas por essa bactéria, mas, fundamentalmente, porque a Escherichia coli  é muito utilizada em técnicas de engenharia genética. Na técnica do DNA recombinante, a Escherichia coli  é amplamente utilizada devido:

a) À facilidade de manipulação em laboratório do DNA cromossômico dessa bactéria não patogênica.

b) À incorporação de enzimas de restrição específicas para o genoma da Escherichia coli , que não podem ser utilizadas em outro material genético.

c) À presença do plasmídeo bacteriano, ao qual são incorporados genes de interesse econômico ou médico que passam a se expressar nas bactérias geneticamente modificadas, acarretando a produção de proteínas específicas.

d) Ao fato de ser o único microrganismo no mundo com o genoma mapeado, o que facilita seu estudo por parte dos pesquisadores.

12. Plantas, animais e microrganismos representam um patrimônio genético de extrema importância para o planeta, considerando também suas potencialidades biotecnológicas. Sobre este assunto, assinale a alternativa incorreta.

a) Para identificar genes de interesse, o DNA extraído das células pode ser e clonado artificialmente milhares de vezes através de uma reação em cadeia da polimerase (PCR).

b) Enzimas de restrição cortam o DNA de forma a produzir pequenos fragmentos cromossômicos com as sequências de nucleotídeos desejadas.

c) Antes de serem implantados em outros organismos, os genes de interesse são incluídos em plasmídios, que funcionam como unidades de transferência.

d) Plantas e animais transgênicos jamais possuirão a capacidade de se recombinar com espécies selvagens no ambiente.

e) Vacinas de DNA se constituem de genes do agente patológico que, após incluídos nas células do indivíduo vacinado, serão expressos e induzirão a produção de anticorpos contra os antígenos gerados.

13. (UEPG) Um organismo que recebe e incorpora, por meio da engenharia genética, um gene de outra espécie é dito transgênico. Com relação aos transgênicos, assinale o que for correto.

01. Na produção do transgênico, o geneticista deve isolar o gene a ser clonado e depois transferir esse para a outra espécie com auxílio da biotecnologia.

02. Um transgênico perde a capacidade de se reproduzir com a sua espécie, o que evita a fuga de genes tão temida pelos ambientalistas.

04. Na biotecnologia, jamais os geneticistas conseguiriam transferir genes de animais para plantas, pois são estruturas completamente diferentes.

08. A transgenia somente obtém sucesso se o gene a ser clonado se inserir no genoma alvo e ali for capaz de realizar suas funções.

Soma das alternativas corretas:

14. (UESPI) As técnicas de clonagem têm produzido uma série de avanços biotecnológicos; contudo não são ferramentas com potencial aplicação:

a) Na conservação do patrimônio genético de plantas e animais sob perigo de extinção.

b) Na criação de plantas cultivadas resistentes a pragas agrícolas.

c) Na síntese de fármacos de interesse humano em bactérias transgênicas.

d) Na produção de seres humanos para fins de transplantes de órgãos.

e) No crescimento de nervos em pessoas com lesões na coluna cervical.

15. (ENADE) As endonucleases de restrição são utilizadas para a obtenção de fragmentos de DNA que contêm os genes. A obtenção do gene D, tendo como base o mapa abaixo, seria possível por digestão com:

15

a) Bg/II.

b) Sa/I.

c) Bam

d) BamHI + Sa/I.

e) Bg/II + Sa/I.

16. (UEM) Em 1994, nos Estados Unidos, iniciou-se a comercialização do tomate longa vida, o primeiro produto agrícola transgênico. Atualmente, são consumidos, na alimentação humana e de animais, cerca de 600 produtos geneticamente modificados. O processo de produção de produtos transgênicos é possível porque:

a) Ocorre recombinação gênica nas espécies.

b) Ocorre transferência de todos os cromossomos de uma espécie para outra.

c) Ocorre transferência de partes do DNA de uma espécie para outra.

d) Existem enzimas de restrição que permitem a incorporação dos genes de outras espécies.

e) Hormônios induzem a troca de genes entre as bactérias e as espécies infectadas.

17. Uma loja de animais mantinha para venda 4 exemplares de Ara ararauna  (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro, a partir de um casal mantido em um criatório autorizado pelo IBAMA. Contudo, os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. Para esclarecer a questão, colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint, ou “impressão digital de DNA”. O DNA foi extraído das células por processos químicos, fragmentado com enzimas de restrição, colocado sobre um gel suporte e submetido à corrente elétrica. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel, que podem ser visualizadas por tratamentos específicos. O padrão de bandas é exclusivo de cada indivíduo. A ilustração a seguir apresenta o resultado do teste.

17

Os resultados obtidos permitem deduzir:

I    II

0   0 – Que o filhote 4 pode ser filho do casal mantido pelo criador.

1   1 – Que o filhote 3 pode ser filho do casal mantido pelo criador.

2   2 – Que o filhote 2 pode ser filho do casal mantido pelo criador.

3   3 – Apenas os exemplares machos podem ser filhos do casal mantido pelo criador.

4   4 – Apenas os exemplares fêmeas podem ser filhos do casal mantido pelo criador.

18. (I OLIMPÍADA BRASILEIRA DE BIOLOGIA) Um horticultor deseja obter indivíduos geneticamente idênticos (clones) a uma samambaia comercialmente valiosa. Para alcançar esse objetivo ele deve:

a) Cultivar os esporos produzidos por essa samambaia.

b) Induzir artificialmente a autofecundação dessa samambaia.

c) Implantar núcleos de esporos dessa samambaia em oosferas anucleadas de outras plantas.

d) Introduzir DNA extraído de folhas dessa samambaia em zigotos de outras plantas.

e) Obter fragmentos de rizoma (caule) dessa samambaia e cultivá-los.

19. (FMJ) Considere duas situações hipotéticas:

1ª SITUAÇÃO: “Maria manteve relações sexuais com dois irmãos, gêmeos dizigóticos (falsos), nascendo destas relações Alfredo”

2ª SITUAÇÃO: “Paula engravidou ao manter relações sexuais com dois irmãos gêmeos monozigóticos (verdadeiros), nascendo Renato.”

Abandonadas e tristes, ambas reclamam na justiça o reconhecimento de paternidade, determinando o juiz a realização dos testes de DNA. Após receber os resultados, a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade de outra. A análise das situações nos permite concluir que o exame de DNA:

a) Não permitiu que o juiz identificasse Alfredo como filho de um dos gêmeos dizigóticos.

b) Permitiu que o juiz identificasse Renato como filho de um dos gêmeos monozigóticos.

c) Permitiu que o juiz identificasse Alfredo como filho de um dos gêmeos dizigóticos.

d) Permitiu identificar quem era o pai de filho de Paula.

e) Não permitiu identificar quem era o pai do filho de Maria.

20. (PUC-SP) Os organismos são ditos transgênicos quando, por técnica de engenharia genética, recebem e incorporam genes de outra espécie, os quais podem ser transmitidos aos seus descendentes. Exemplos desses organismos são as plantas transgênicas, receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas. Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora, diversas condições devem ser observadas. Entretanto, fundamentalmente, essa técnica é possível porque:

a) Cada organismo apresenta seu próprio código genético.

b) O código genético é comum a todos os seres vivos.

c) O código genético é degenerado.

d) A técnica permite trocar o código genético do organismo doador do gene.

e) A técnica permite trocar o código genético do organismo receptor.

gab

 

Publicado por: Djalma Santos | 13 de outubro de 2015

TESTES DE MITOSE (4/5)

01. (UNCISAL) Uma célula se reproduz ao executar uma sequência organizada de eventos em que ela duplica seu conteúdo e então se divide em duas. Este ciclo de duplicação e divisão, conhecido como ciclo celular, caso não ocorra de maneira bem regulada, pode levar à formação de neoplasia. Os componentes centrais do sistema de controle do ciclo celular são membros da seguinte família de proteínas:

a) CDKs.

b) Helicases.

c) Polimerases.

d) Bcl-2.

e) Caspase.

02. (UPE) As colunas a seguir se referem a uma divisão celular vegetal, que envolve processos de divisão do núcleo e do citoplasma. Na coluna I, são encontradas imagens que exemplificam a mitose e a citocinese; na coluna II, encontram-se as denominações dos eventos que ocorrem durante a divisão celular, e, na coluna III, as descrições das características de cada evento.

02

Assinale a alternativa que faz a correlação correta entre imagem, evento da divisão celular e sua respectiva característica.

a) 1-III-D; 2-I-C; 3-V-A; 4-IV-E; 5-II-B.

b) 1-IV-D; 2-III-A; 3-I-C; 4-II-B; 5-V-E.

c) 1-IV-B; 2-II-A; 3-I-C; 4-III-D; 5-V-E.

d) 1-V-B; 2-I-A; 3-II-C; 4-III-D; 5-IV-E.

e) 1-V-E; 2-IV-B; 3-III-D; 4-I-C; 5-II-A.

03. (UEA) A figura traz cromossomos humanos fotografados em células durante o processo de divisão celular.

03

O cromossomo indicado na figura é formado por:

a) Duas fitas duplas de DNA condensadas na interfase.

b) Duas fitas simples de DNA condensadas na interfase.

c) Uma fita dupla de DNA condensada na prófase.

d) Duas fitas duplas de DNA condensadas na prófase.

e) Duas fitas simples de DNA condensadas na prófase.

04. (UFPB) Um pesquisador observou que, no início do desenvolvimento embrionário de um determinado tipo de animal, as divisões mitóticas ocorriam normalmente, aumentando o número de células, sem que, no entanto, houvesse aumento significativo no tamanho do embrião. Relacionado a esse fato, observou, também, que dois períodos do ciclo celular dessas células eram de duração muito curta. De acordo com essas observações e com os eventos biológicos que acontecem em cada período do ciclo celular, é possível depreender-se que o crescimento das células embrionárias, em questão, ocorre nos períodos do ciclo celular:

a) G1 e S.

b) S e G2.

c) G2 e mitose.

d) Mitose e G1.

e) G1 e G2.

05. (FAZU-MG) Entre as frases abaixo em relação à mitose, uma incorreta. Assinale-a?

a) É um processo muito importante para o crescimento dos organismos.

b) A célula mãe dá origem a duas células filhas com metade do número de cromossomos.

c) As células filhas são, do ponto vista genético, idênticas à célula mãe.

d) Ocorre nas células somáticas tanto de animais como de vegetais.

06. (PUC-SP) No esquema abaixo, está representada uma célula em anáfase mitótica. Com base nesse esquema, pode-se dizer que o organismo do qual proveio tal célula apresenta um cariotipo com:

06

a) 8 cromossomos acrocêntricos.

b) 8 cromossomos metacêntricos.

c) 4 cromossomos acrocênticos.

d) 4 cromossomos metacêntricos.

e) todos os cromossomos acrocêntricos.

07. (FIR) O tempo de vida de uma célula depende de sua especialização. Uma célula só exerce efetivamente suas funções num organismo, enquanto se encontra no período de:

a) Metáfase.

b) Prófase.

c) Interfase.

d) Anáfase.

e) Telófase.

08. (PUC-RS) Para fazer um estudo de um cariótipo, qual a fase da mitose que seria mais adequada usar, tendo em vista a necessidade de ser obter a maior nitidez dos cromossomos, em função do seu maior grau de espiralização?

a) Prófase.

b) Prometáfase.

c) Anáfase.

d) Telófase.

e) Metáfase.

09. (UFV) Observe o esquema representativo de um ciclo celular e assinale a alternativa incorreta:

09

a) A duplicação do material genético ocorre na subfase S.

b) A separação das cromátides irmãs ocorre em A.

c) A mitose compreende as fases P, M, A e T.

d) A quantidade de DNA está reduzida à metade em G2.

e) A interfase compreende as subfases G1, S e G2.

10. (FUVEST) Com base das figuras abaixo que representam a sequência de eventos cromossômicos que ocorrem na duplicação de uma célula somática assinale a alternativa correta.

10

a) A duplicação do DNA ocorre na etapa representada por D.

b) Considerando um gene autossômico H, ao final da fase A existem duas cópias desse gene.

c) Considerando um gene autossômico G, na fase E existem, em cada célula-filha, duas cópias desse gene.

d) Considerando um gene autossômico I, na fase B existe uma cópia desse gene,

e) Considerando um gene autossômico M, nas fases C e D existem, respectivamente, uma e duas cópias desse gene.

11. (UEL) As figura abaixo mostram fases da mitose.

11

A fase não representada é a:

a) Interfase.

b) Prófase.

c) Metáfase.

d) Anáfase.

e) Telófase.

12. (UNIP-SP) Durante o processo mitótico de divisão celular ocorrem os seguintes eventos:

I. Início da condensação cromossômica.

II. Divisão dos centrômeros e separação das cromátides.

III. Acontece a citocinese.

IV. Cromossomos alinhados no plano equatorial da célula.

A sequência correta de tais eventos é:

a) I → II → III → IV.

b) I → IV → II → III.

c) I → III → II → IV.

d) II → I → III → IV.

e) III → II → I → IV.

13. (UEL) Leia o texto a seguir.

Quando se fala em divisão celular, não valem as regras matemáticas: para uma célula dividir significa duplicar. A célula se divide ao meio, mas antes duplica o programa genético localizado em seus cromossomos. Isso permite que cada uma das células-filhas reconstitua tudo o que foi dividido no processo.

(AMABIS, J. M.; MARTHO, G. R. Biologia. v.1. São Paulo:Moderna, 1994. p.203.)

Considerando uma célula haploide com 8 cromossomos (n = 8), assinale a alternativa que apresenta, corretamente, a constituição cromossômica dessa célula em divisão na fase de metáfase da mitose.

a) 8 cromossomos distintos, cada um com 1 cromátide.

b) 8 cromossomos distintos, cada um com 2 cromátides.

c) 8 cromossomos pareados 2 a 2, cada um com 1 cromátide.

d) 8 cromossomos pareados 2 a 2, cada um com 2 cromátides.

e) 8 cromossomos pareados 4 a 4, cada um com 2 cromátides.

14. (UCPel) As células dos seres vivos, durante o crescimento, passam por um processo de divisão celular chamado (I)_____. Esse processo é contínuo, mas, por motivos didáticos, é divido em fases: (II)______ , (III)_____ , anáfase e telófase. O momento da separação do citoplasma no final é chamado de (IV)_____.

a) I – mitose, II – prometáfase, III – prófase, IV – citocinese.

b) I – mitose, II – prófase, III – metáfase, IV – citocinese.

c) I – meiose, II – prófase, III – metáfase, IV – citocinese.

d) I – meiose, II – prometáfase, III – prófase, IV – interfase.

e) I – mitose, II – prófase, III – metáfase, IV – interfase.

15. (IFMT) A maioria de nossas células é substituída várias vezes durante a vida. Assim, de certa maneira, nosso corpo é constantemente reconstituído enquanto vivemos. Isso é possível graças à duplicação das células pelo processo de mitose. Com relação ao processo de divisão celular denominado mitose, assinale a alternativa correta.

a) Esse processo tem como característica principal a redução pela metade do número de cromossomos, nas células-filhas.

b) Esse processo é feito entre 30 e 60 minutos, dividido em duas fases, mitose I e mitose II.

c) Na prófase I da mitose, ocorre a troca de pedaços entre cromossomos homólogos.

d) Os cromossomos, previamente, duplicados são distribuídos, equitativamente, entre as duas células-filhas.

e) Ocorre somente em células germinativas.

16. (UCS) O crescimento corporal em um organismo multicelular e a reprodução em um organismo unicelular dependem do processo de divisão celular que faz parte de outro processo chamado ciclo celular. Relacione as fases, listadas na COLUNA A, ao ciclo celular, apontado na COLUNA B.

COLUNA A

1. Telófase

2. Metáfase

3. Anáfase

4. Prófase

COLUNA B

(  ) Formação do fuso acromático e condensação dos cromossomos

(  ) Migração dos cromossomos para os polos da célula

(  ) Início da citocinese e descondensação dos cromossomos

(  ) Alinhamento dos cromossomos no equador da célula

Assinale a alternativa que completa correta e respectivamente os parênteses, de cima para baixo.

a) 1 – 2 – 3 – 4.

b) 3 – 4 – 2 – 1.

c) 4 – 2 – 3 – 1.

d) 2 – 3 – 1 – 4.

e) 4 – 3 – 1 – 2.

17. (IFMT) Analise o quadrinho a seguir.

17

Considerando o texto, a preocupação da mãe justifica-se porque o processo de mitose nos seres unicelulares:

a) Reduz o número de cromossomos a metade, prejudicando a célula, pois esta perde metade dos seus genes.

b) É importante para os jovens, pois neles isso ocorre para formação de gametas.

c) Duplica o núcleo, dificultando o comando e a coordenação das atividades da célula.

d) Tem a finalidade de reprodução, pois a partir de uma célula são formadas duas idênticas.

e) Impede a célula de realizar os processos de transcrição e tradução.

18. (FUVEST) A sequência de fotografias abaixo mostra uma célula em Interfase e outras em etapas da mitose, até a formação de novas células.

18

Considerando que o conjunto haploide de cromossomos corresponde à quantidade N de DNA, a quantidade de DNA das células indicadas pelos números 1, 2, 3 e 4 é, respectivamente:

a) N, 2N, 2N e N.

b) N, 2N, N e N/2.

c) 2N, 4N, 2N e N.

d) 2N, 4N, 4N e 2N.

e) 2N, 4N, 2N e 2N.

19. (UNICENTRO) Leia o texto a seguir.

No início desta fase, os centrossomos (com os seus centríolos) replicam-se e os dois centrômeros migram para os lados opostos do núcleo. Ao mesmo tempo, aparecem microtúbulos entre os dois centrossomos, que assumem o formato de bola de futebol americano, o fuso. Outros microtúbulos dispõem-se radialmente aos centrossomos, formando os ásteres. Nesse momento, a cromatina nuclear difusa condensa-se em cromossomos visíveis.

(Adaptado de: HICKMAN JR., C. P; ROBERTS, L. S.; LARSON, A. Princípios Integrados de Zoologia. 11.ed. Rio de Janeiro: Editora Guanabara Koogan, 2004, p.48.)

Assinale a alternativa que apresenta, corretamente, a fase da mitose descrita por esse texto.

a) Anáfase.

b) Metáfase.

c) Prófase.

d) Telófase.

20. (UFla) Nos seres multicelulares, a mitose é um processo que tem como principal função:

a) O movimento celular.

b) A produção de gametas.

c) A produção de energia.

d) A expressão gênica.

e) O crescimento.

gab

 

Publicado por: Djalma Santos | 7 de outubro de 2015

TESTES DE BOTÂNICA (VII)

01. (UNICENTRO) Com base nos conhecimentos sobre a germinação da semente, assinale a alternativa que apresenta, corretamente, o nome da região inferior do embrião, que fica localizada entre a radícula e o ponto de implantação do cotilédone.

a) Caulículo.

b) Coleóptilo.

c) Epicótilo.

d) Hipocótilo.

e) Plúmula.

02. (UEPG) Entre as angiospermas, quando estames e pistilo ocorrem na mesma flor, geralmente ocorrem mecanismos que dificultam a autofecundação. Com relação aos mecanismos que atuam dificultando a autofecundação e suas consequências nessas plantas, assinale o que for correto.

01. A dicogamia é um mecanismo que atua dificultando a autofecundação. Nesse caso, ocorre o amadurecimento do androceu e do gineceu em épocas diferentes.

02. A proterandria ocorre quando o gineceu amadurece primeiro que o conjunto de sépalas e pétalas.

04. O mecanismo de autoincompatibilidade promove uma incompatibilidade entre pólen e gineceu, não ocorrendo germinação do grão de pólen na própria flor.

08. Todos os mecanismos que dificultam a autofecundação em plantas atuam na diminuição da variabilidade genética.

16. A hercogamia é ocorrência de uma barreira física impedindo a queda do pólen no estigma da mesma flor.

Soma das alternativas corretas:

03. (UEM) Sobre a estrutura e a classificação dos frutos, é correto afirmar que:

01. Aquênio é um tipo de fruto indeiscente com uma só semente que se liga à parede do fruto por um só ponto.

02. Morango, abacaxi, figo e uva são classificados como frutos simples, verdadeiros, carnosos e indeiscentes.

04. Abobrinha, tomate, pepino e goiaba são exemplos de frutos carnosos do tipo baga.

08. O coco-da-baía apresenta mesocarpo fibroso com retenção de ar que facilita sua dispersão por hidrocoria.

16. A parte macia e comestível do pêssego é o endocarpo.

Soma das alternativas corretas:

04. (FATEC) As sequoias são árvores que ocorrem na região oeste da América do Norte e que pertencem ao grupo das coníferas, também chamado de gimnospermas. Elas podem atingir mais de 100 metros de altura e para que ocorra fotossíntese em suas folhas, a água captada pelas raízes precisa percorrer toda essa distância e alcançar as suas copas. Em um edifício de altura equivalente, seria necessário o uso de potentes bombas d’água para realizar o transporte de água até os andares mais altos. Já no caso das sequoias e de qualquer outra planta de grande porte com vasos condutores de seiva, o transporte da água até o topo é explicado pela teoria da coesão-tensão de Dixon. De acordo com essa teoria, o transporte da água no interior das sequoias é decorrente, principalmente:

a) Do bombeamento feito por vasos pulsáteis das raízes.

b) Do aumento da temperatura das folhas e do tronco.

c) Da perda de água nas folhas por transpiração.

d) Da entrada contínua de água pelas raízes.

e) Da movimentação das folhas pelo vento.

05. (URCA) As palmeiras são monocotiledôneas presentes nas áreas tropicais de todo o mundo. São exemplos de palmáceas típicas da caatinga nordestina:

a) Babaçu e catolé.

b) Licuri e coqueiro.

c) Catingueira e catolé.

d) Carnaúba e macaúba.

e) Palmeira imperial e coqueiro.

06. (UNEASPAR) Ao longo da evolução das plantas, estas também tiveram ancestrais que partiram do ambiente aquático para a conquista do ambiente terrestre. Qual foi o primeiro grupo de plantas que desenvolveu vasos condutores, possibilitando a formação das florestas sobre o continente.

a) Algas.

b) Briófitas.

c) Pteridófitas.

d) Gimnospermas.

e) Angiospermas.

07. (UNICENTRO) Observe a figura a seguir que representa um corte transversal em um tipo de semente.

07

Com base nessa figura e nos conhecimentos sobre sementes, assinale a alternativa correta.

a) 1 representa uma estrutura cuja função é dar origem aos primórdios da raiz.

b) 2 representa uma estrutura que participa na nutrição e na produção de hormônios.

c) 3 representa uma estrutura cuja função é originar os primórdios de folhas.

d) 4 representa estruturas cuja função é transferir reservas para o embrião.

e) 6 representa uma estrutura cuja função é dar origem aos primórdios do caule.

08. (UEM) Sobre o ciclo de vida das plantas, assinale a(s) alternativa(s) correta(s).

01. O tubo polínico é originado pelos gametófitos masculinos das gimnospermas e das angiospermas, sendo responsável pelo processo de fecundação em ambos os grupos.

02. A fecundação em briófitas e pteridófitas consiste na fusão de um óvulo com um núcleo espermático.

04. Um óvulo maduro de angiosperma contém o saco embrionário ou gametófito feminino, resultante do desenvolvimento do megásporo.

08. As plantas vasculares apresentam como característica comum a dominância da geração haploide.

16. Os esporos, os gametófitos e os anterozoides são constituídos por células haploides; e os esporângios, os arquegônios e os anterídios são diploides.

Soma das alternativas corretas:

09. (UEL) As samambaias pertencem ao grupo das pteridófitas, as quais possuem características adaptativas que permitiram a conquista do ambiente terrestre com mais eficiência que o grupo das briófitas. Sobre as adaptações morfológicas e reprodutivas que possibilitaram o sucesso das pteridófitas no ambiente terrestre, considere as afirmativas a seguir.

I. A predominância da fase esporofítica.

II. O aparecimento dos tecidos xilema e floema.

III. O desenvolvimento de rizoides para fixação.

IV. O surgimento dos esporos para reprodução.

Assinale a alternativa correta.

a) Somente as afirmativas I e II são corretas.

b) Somente as afirmativas I e IV são corretas.

c) Somente as afirmativas III e IV são corretas.

d) Somente as afirmativas I, II e III são corretas.

e) Somente as afirmativas II, III e IV são corretas.

10. (UNISINOS) O cladograma abaixo mostra as relações evolutivas entre os grandes grupos de plantas terrestres:

10

Os números I a IV demonstram características que surgiram ao longo da evolução e que diferenciaram os grupos. Qual das alternativas abaixo apresenta a correta sequência de características?

a) I – vasos condutores; II – arquegônios e anterídios; III – sementes; IV – flores.

b) I – arquegônios e anterídios; II – vasos condutores; III – sementes; IV – flores.

c) I – vasos condutores; II – sementes; III – arquegônios e anterídios; IV – flores.

d) I – arquegônios e anterídios; II – sementes; III – vasos condutores; IV – flores.

e) I – arquegônios e anterídios; II – flores; III – sementes; IV – vasos condutores.

11. (UDESC) A figura abaixo representa esquematicamente uma flor.

11

Analise as proposições em relação à representação da flor, na acima.

I. O esquema representa uma flor hermafrodita.

II. O receptáculo floral em algumas espécies pode se desenvolver e originar frutos.

III. A flor esquematizada é típica do grupo das Gimnospermas.

IV. As pétalas podem servir como elementos atrativos no processo de polinização.

V. No estigma ocorre a fixação do grão de pólen.

VI. O óvulo fecundado pelo grão de pólen dará origem ao embrião.

Assinale a alternativa correta.

a) Somente as afirmativas III, IV e VI são verdadeiras.

b) Somente as afirmativas I, II, IV e VI são verdadeiras.

c) Somente as afirmativas II, III e V são verdadeiras.

d) Somente as afirmativas I, IV e V são verdadeiras.

e) Somente as afirmativas I, II, V e VI são verdadeiras.

12. (UNISC) Plantas que apresentam:

I. Formação de sementes envoltas por fruto.

II. Formação de esporos no interior de estruturas denominadas cápsulas.

III. Formação de esporos em esporângios e estes em geral na superfície abaxial das folhas que apresentam tecidos de condução.

IV. Formação de sementes não envoltas em fruto.

Assinale a alternativa que, respectivamente, classifica os grupos de forma adequada.

a) I-angiospermas; II-briófitas; III-pteridófitas; IV-

b) I-gimnospermas; II-briófitas; III-pteridófitas; IV-

c) I-angiospermas; II-gimnospermas; III-pteridófitas; IV-briófitas.

d) I-gimnospermas; II-briófitas; III-angiospermas; IV-pteridófitas.

e) I-angiospermas; II-gimnospermas; III-briófitas; IV-pteridófitas.

13. (UPF) Observe os caules abaixo, indicados pelas setas, nas figuras A, B, C e D.

13

(Disponível em: http://www.plantasonia.com.br/pt.wikipedia.org.

/auladecienciasdanatureza.blogspot.com. Acesso em 04 out. 2014)

Esses caules são denominados, respectivamente:

a) Estolão / colmo / bulbo / volúvel.

b) Haste / rastejante / tubérculo / escapo.

c) Estipe / rizoma / bulbo / haste.

d) Colmo / rizoma / tubérculo / volúvel.

e) Colmo / haste / tubérculo / estipe.

14. (UCPel) As quatro partes básicas que uma folha pode apresentar são uma lâmina foliar, um pedúnculo, uma expansão basal, que reveste o caule, e projeções filamentosas ou lâminas. Essas partes da folha são chamadas, respectivamente, de:

a) Bainha, pecíolo, limbo e estípulas.

b) Limbo, estípulas, pecíolo e bainha.

c) Pecíolo, limbo, estípulas e bainhas.

d) Pecíolo, bainha, estípulas e limbo.

e) Limbo, pecíolo, bainha e estípulas.

15. (PUC-RS) Para responder esta questão, leia as informações e as afirmativas que seguem.

Foi noticiado recentemente o alerta preocupante sobre a perda na diversidade de abelhas; além disso, a quantidade de abelhas tem diminuído no mundo. Pragas e uso de pesticidas estão entre as principais causas desse fenômeno, que já afeta o Brasil. Apicultores relataram que 30% das abelhas de Santa Catarina desapareceram desde 2012. Nesse contexto, afirma-se que:

I. A presença de abelhas é essencial, pois polinizam flores presentes em plantações de frutas, legumes e grãos.

II. A abelha coleta o pólen, que adere aos pelos do seu corpo quando em contato com as anteras.

III. As monoculturas seriam vantajosas para a manutenção da diversidade das colmeias.

Está/Estão correta(s) a(s) afirmativa(s):

a) I, apenas.

b) II, apenas.

c) I e II, apenas.

d) II e III, apenas.

e) I, II e III.

16. (PUC-PR) Em algumas plantas de interior, como a famosa “comigo-ninguém-pode”, após uma rega intensa, podemos observar que suas folhas “choram”, ou seja, começam a gotejar, o que comumente é uma explicação de “mau-olhado”. Um bom observador, entretanto, saberia que esse fenômeno está relacionado a uma estrutura da folha que elimina o excesso de água que a planta absorveu. Essa estrutura é o(a):

a) Estômato.

b) Lenticela.

c) Hidatódio.

d) Plasmodesma.

e) Catáfilo.

17. (IFSC) No ambiente terrestre as plantas formam a base de uma cadeia alimentar que sustenta a vida por meio da fotossíntese. Você já imaginou como seria a vida sem, por exemplo, arroz, feijão, pão, frutas, legumes, chocolate, tecidos de algodão, linho e flores? A espécie humana depende das plantas não apenas como alimento, mas também como fonte de matéria-prima para a produção de madeira, tecidos, papel, medicamentos e uma infinidade de produtos. Preservar florestas e outros ecossistemas naturais é preservar a vida.

FONTE: Linhares, S. Gewandsznajder, F. Biologia hoje. 2ª ed, v II. São Paulo: Ática, 2013.

Sobre a Fotossíntese e o Reino Vegetal, assinale no cartão-resposta a soma da(s) proposição(ões) correta(s).

01. O Reino Plantae ou Vegetal tem como componentes organismos eucariontes, pluricelulares, autotróficos e fotossintetizantes.

02. A fotossíntese é o processo pelo qual a energia luminosa é captada e convertida em energia química. A capacidade de executar a fotossíntese está presente em eucariontes e procariontes.

04. As Criptógamas são as plantas que não produzem sementes, flores ou frutos, e que se reproduzem por meio de esporos, com estruturas produtoras de gametas pouco evidentes. Possuem duas divisões: Briófitas e Pteridófitas. Fanerógamas são as plantas que produzem sementes, flores e frutos, onde os óvulos e o pólen são os gametas feminino e masculino, ou seja, as estruturas para reprodução são claramente visíveis. As Fanerógamas possuem duas divisões: Gimnospermas e Angiospermas.

08. As Pteridófitas são consideradas os primeiros vegetais vasculares e portadores de semente, ou seja, são traqueófitas e espermatófitas.

16. As Gimnospermas foram subdivididas em duas classes: as monocotiledôneas e as dicotiledôneas. São exemplos de monocotiledôneas: capim, cana de açúcar e milho. São exemplos de dicotiledôneas: feijão, amendoim, soja e ervilha.

Soma das alternativas corretas:

18. (PUC-RIO) Os estômatos são estruturas formadas por um conjunto de células localizados geralmente na epiderme foliar, constituindo um canal para trocas gasosas e transpiração nos vegetais. Considerando o processo de transpiração vegetal, marque a alternativa incorreta sobre os estômatos.

a) Mantêm-se abertos na presença de luz.

b) Ficam abertos com suprimento de água ideal.

c) Abrem-se com uma baixa concentração de CO2 na folha.

d) Fecham-se para reduzir a perda d’água.

e) Abrem-se quando o transporte de K+ é inibido pelo ácido abscísico (ABA), aumentando a transpiração.

19. (UPE) Um naturalista amador, interessado por plantas, poderia iniciar seus estudos com as Angiospermas, por causa da ampla distribuição de espécies no mundo. Algumas características permitem dividi-las em duas classes. Assim, o naturalista poderia explorar um fruto, cortando-o ao meio e procurando o número de cotilédones, dois ou um, dicotiledônea ou monocotiledônea, respectivamente. Além dessas características, outras diferenças podem ser observadas na tabela a seguir:

19

 

Estão corretas as características estampadas na tabela em:

a) I e III, apenas.

b) II, apenas.

c) I, II, III e IV.

d) II e IV, apenas.

e) II, III e IV, apenas.

20. (IFSudeste-Mg) O estudo do reino vegetal possibilita adquirir mais conhecimentos que podem ser aplicados ao nosso cotidiano, como por exemplo: na produção de alimentos e na jardinagem. Sobre esse reino, foram feitas afirmativas. Marque a incorreta.

a) Os meristemas apicais do caule de laranjeira originam novos ramos e flores.

b) Na zona pilífera da raiz da cana‐de‐açúcar, ocorre a absorção de água que e necessária para a fotossíntese.

c) Vários insetos são importantes agentes polinizadores de angiospermas.

d) As briófitas são avasculares e necessitam de água para realizar a reprodução sexuada.

e) As samambaias, por serem pteridófitas, têm ausência de xilema.

gab

 

Publicado por: Djalma Santos | 7 de outubro de 2015

TESTES DE GENÉTICA MOLECULAR (4)

01. (X Olimpíada Brasileira de BIOLOGIA)

O texto abaixo descreve bioquimicamente as diferenças observadas por Mendel quanto à forma da semente. Analise o texto e responda esta questão

• O alelo A que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases que codifica a enzima SBE-1 (starch-branching enzyme ou enzima ramificadora do amido).

• O alelo a que codifica a semente rugosa, é um fragmento de DNA com uma inserção de 800 pares de bases, portanto o gene possui 4,1 mil pares de bases e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, levando a um maior acumulo de água, e quando a semente seca torna-se rugosa.

A garantia da expressão gênica com a consequente produção da proteína depende de um intermediário que migrará do núcleo ao citoplasma para garantir sua codificação. A molécula que possui esta função é o:

a) DNA.

b) RNAt.

c) RNAm.

d) Transcrito primário.

e) RNAr.

02. (UNICAMP) Em um experimento, um segmento de DNA que contém a região codificadora de uma proteína humana foi introduzido em um plasmídeo e passou a ser expresso em uma bactéria. Considere que o 50º códon do RNA mensageiro produzido na bactéria a partir desse segmento seja um códon de parada da tradução. Nesse caso, é correto afirmar que:

a) A proteína resultante da tradução desse RNA mensageiro possui 50 aminoácidos.

b) A proteína resultante da tradução desse RNA mensageiro possui 49 aminoácidos.

c) A proteína resultante da tradução desse RNA mensageiro possui 150 aminoácidos.

d) Nenhuma proteína é formada, pois esse RNA mensageiro apresenta um códon de parada.

03. Câncer: Novos alvos para tratamento

Os cânceres, até recentemente definidos em função da célula tumoral propriamente dita, hoje são encarados como doenças mais complexas, que envolvem diferentes tipos de células presentes no mesmo microambiente: células de defesa, células de vasos sanguíneos e células de suporte dos tecidos. Essa nova perspectiva permitiu o surgimento de outros alvos para as terapias contra esses males. À medida que as interações entre essas diferentes células são mais bem entendidas é possível desenvolver novas formas de tratamento. Além disso, drogas de uso já consagrado contra outras doenças começam a ganhar novas indicações, atuando como tratamento complementar no câncer. Os cânceres são doenças do material genético (o genoma) de nossas células e decorrem do acúmulo progressivo de mutações, ou seja, alterações no código genético. As mutações fazem com que células que antes executavam um programa bem definido, associado às suas funções em seu tecido de origem, cresçam de maneira descontrolada. Esse crescimento alterado é consequência não só da duplicação celular desordenada, mas também da progressiva resistência à morte celular (como se as células tivessem bebido o “elixir da vida eterna”). Além disso, as células cancerosas ultrapassam os limites dos tecidos de origem, adquirem a capacidade de modificar o ambiente que as cerca, desrespeitam fronteiras e migram pelos diversos tecidos do corpo, podendo estabelecer novos tumores – as metástases – ao se fixarem em locais distantes do ponto de origem. A capacidade de invadir os tecidos vizinhos e de formar as metástases é responsável, em última análise, pela morte de dois a cada três pacientes com o diagnóstico de câncer.

Sobre as divisões celulares e o câncer, assinale o item correto.

a) O crescimento de maneira desordenada, como citado no texto, é promovido pela ação dos genes de supressão tumoral.

b) Uma possível causa para a progressiva resistência à morte celular é a ação dos protooncogenes e as informações contidas no último parágrafo do texto são pertinentes aos tumores malignos.

c) Pode-se inferir do texto que todo câncer é hereditário.

d) A razão de uma pessoa desenvolver geneticamente um câncer está fundamentada na inexistência dos genes de supressão tumoral.

e) Com o tratamento quimioterápico, as divisões celulares são bloqueadas, mas a estrutura celular que sofre os efeitos da quimioterapia não é responsável por orientar as divisões celulares.

04. O material genético tem a função de armazenar, transmitir e expressar as informações nele contido. Sobre estes processos e seus constituintes, assinale a alternativa em que as todas as correlações estão corretas.

I. DNA.

II. RNA.

III. Proteína.

a. Ligações peptídicas.

b. Pontes de hidrogênio.

c. Pontes dissulfeto.

d. Anticódon.

e. Ligações fosfodiéster.

f. Bases nitrogenadas.

a) I-e, II-d, III-c.

b) I-b, II-a, III-f.

c) I-f, II-c, III-a.

d) I-e, II-f, III-d.

e) I-d, II-b, III-a.

05. A descoberta do código genético data do início da década de 1960, quando já se sabia que existia uma relação entre a sequência de nucleotídeos presentes nos ácidos nucleicos e a sequência de aminoácidos das proteínas. Sobre o código genético, julgue as afirmativas a seguir:

I. O código genético é considerado universal, pois seu funcionamento é idêntico para todos os seres vivos.

II. Ele é degenerado, pois um mesmo aminoácido pode ser codificado por mais de um códon.

III. Esse código é estabelecido por meio da complementaridade entre as bases nitrogenadas e o RNAr (ribossômico).

a) V – F – F

b) V – V – V

c) F – V – V

d) F – V – F

e) V – V – F.

06. (FCM-PB) Luciana é uma menina branca que apresenta pequenas protuberâncias nas áreas da pele expostas ao sol. A mãe relatou ao médico que Luciana, brinca na praia todos os dias ao sol quente. O médico falou que as protuberâncias pareciam ser pequenos tumores benignos e deviam ser removidos cirurgicamente e alertou para evitar o sol o máximo possível. A partir dos diagnósticos, concluiu que a menina apresentava uma doença autossômica recessiva, Xeroderma pigmentoso, que tem como agravo as mutações produzidas pela radiação ultravioleta. As mutações ocorrem ao nível molecular em qual estrutura?

a) Ácido ribonucleico.

b) Proteínas.

c) Ácido desoxirribonucleico.

d) Enzimas lisossomais.

e) Nucleoproteínas.

07. (UPE) Leia o texto a seguir:

Os antibióticos com aplicações terapêuticas devem ter toxicidade seletiva. Devem ser tóxicos para o agente causador da doença, mas não para o hospedeiro, por atuarem em etapas do metabolismo de microrganismo e não do ser infectado. Alguns exemplos podem ser citados. A ampicilina impede a formação do peptidoglicano, que envolve a membrana plasmática da bactéria, acarretando a lise bacteriana. O cloranfenicol inibe exclusivamente a síntese de proteínas bacterianas. A daptomicina modifica a permeabilidade da membrana plasmática da bactéria, fazendo os metabólitos importantes serem perdidos. As quinolonas inibem a duplicação do cromossomo bacteriano ou da transcrição. Trimetoprima e sulfas, por sua vez, imitam substâncias usadas pela bactéria e se ligam a enzimas, inibindo-as.

Disponível em:  http://www.moderna.com.br/lumis/portal/file/fileDownload.jsp?fileId=8A7A83CB30D6852A0130D7BC0E4E107A. Adaptado.

Observe a figura que indica os principais modos de ação de antibióticos sobre bactérias por INIBIÇÃO DE PROCESSOS ou DANOS A ESTRUTURAS CELULARES, por meio de balões numerados.

07

(Disponível em: http://www.moderna.com.br/lumis/portal/file/fileDownload.jsp?fileId=8A7A83CB30D6852A0130D7BC0E4E107A. Adaptada.)

Assinale a alternativa que apresenta a correlação entre os antibióticos e o seu modo de atuação indicado no texto e nos balões numerados.

a) Ampicilina (1), cloranfenicol (2), daptomicina (3), quinolonas (4), trimetoprima e sulfa (5).

b) Ampicilina (2), cloranfenicol (1), daptomicina (4), quinolonas (5), trimetoprima e sulfa (3).

c) Ampicilina (3), cloranfenicol (2), daptomicina (5), quinolonas (1), trimetoprima e sulfa (4).

d) Ampicilina (4), cloranfenicol (5), daptomicina (3), quinolonas (2), trimetoprima e sulfa (1).

e) Ampicilina (5), cloranfenicol (4), daptomicina (3), quinolonas (1), trimetoprima e sulfa (2).

08. (UEPG) O ácido nucleico dos vírus contém as informações (genes) para se multiplicar e para produzir novas partículas virais. Essas informações constituem o genoma viral. Com relação ao genoma viral, assinale o que for correto.

01. Comparados a outros organismos, os vírus têm poucos genes. Genomas bacterianos contêm aproximadamente 4 mil genes para grande parte das bactérias. Já o maior genoma viral, o da varíola, contém cerca de 200 genes. Vírus pequenos como o HIV (vírus da AIDS) e o vírus do sarampo possuem menos de 10 genes.

02. O genoma dos vírus pode ser constituído por ácido desoxirribonucleico (vírus de DNA) ou por ácido ribonucleico (vírus de RNA).

04. O ácido nucleico presente no vírus pode ser de cadeia simples ou de cadeia dupla. No caso dos vírus de RNA, a maioria tem cadeia simples, apesar de existirem algumas exceções, a exemplo dos vírus de RNA cadeia dupla que atacam plantas, e o reovírus, que causa diarreia em seres humanos.

08. Os vírus de RNA cadeia simples podem ser divididos em três tipos básicos: vírus de cadeia positiva – aqueles cujo RNA do genoma têm a mesma sequência de bases nitrogenadas que os RNAs por ele traduzidos; vírus de cadeia negativa – aqueles, cujos RNAs formados têm sequência de bases nitrogenadas complementar à do RNA genômico e; retrovírus – os que contêm cadeia simples de RNA associada à transcriptase reversa, uma enzima que produz DNA tendo como modelo o RNA viral.

Soma das alternativas corretas:

09. Considere a quantidade normal de DNA do núcleo de uma célula da mucosa duodenal humana igual a 2C. A partir dessa informação, pode-se prever que:

a) Essa mesma quantidade seja encontrada no núcleo de um linfócito normal.

b) Essa mesma quantidade seja encontrada no núcleo de um espermatozoide normal.

c) Uma quantidade igual a C seja encontrada no núcleo de um neurônio normal.

d) Uma quantidade igual a C/2 seja encontrada no núcleo de um óvulo normal.

e) Uma quantidade igual a 4C seja encontrada no núcleo de um blastômero que apresente 46 fios de cromatina.

10. “Não escapou à nossa atenção que o pareamento específico que estamos postulando sugere imediatamente um possível mecanismo de cópia para o material genético.”

(J. Watson e F. Crick. Molecular structure of nucleic acids. Revista Nature, n. 4356, p. 737, 25 abr. 1953.)

Com base na afirmação destacada no texto de Watson e Crick, em seu trabalho original, e em seus conhecimentos sobre a importância do trabalho desses dois cientistas, escolha a alternativa correta.

a) O pareamento citado ocorria entre os grupamentos fosfato e as desoxirriboses do DNA.

b) A existência de duas cadeias pareadas no DNA possibilitava um processo simples de autoduplicação.

c) O mecanismo de cópia citado serviria apenas para a síntese de moléculas de RNA mensageiro.

d) O pareamento ocorreria sempre entre duas bases púricas ou entre duas bases pirimídicas.

e) Não haverá relação entre o pareamento do DNA e a cópia do material genético.

11. No início da década de 1980, os pesquisadores chamaram a atenção para o fato de que a maior parte da variabilidade no nível molecular é seletivamente neutra, ou seja, a estrutura primária de uma proteína pode variar em diferentes indivíduos, sem que essa variação implique diferentes níveis de adaptação do organismo. Suponha que, de dois indivíduos não aparentados, obteve-se uma amostra de uma mesma proteína. Pode-se dizer que, nessas duas pessoas, essa proteína:

a) Terá a mesma composição de aminoácidos.

b) Será codificada por uma mesma sequência de bases do DNA.

c) Será codificada por uma mesma sequência de bases do RNAm.

d) Terá uma mesma função e eficiência biológica em uma via metabólica específica.

e) Terá a mesma carga elétrica e o mesmo peso molecular.

12. “A vida é um sistema informático que se reproduz e leva à diversidade. A reprodução da informação é suficientemente fiel para memorizar o que se acumulou durante a evolução e, ao mesmo tempo, suficientemente infiel para que haja mudanças, aumentando a diversidade.”

(Miroslav Radman)

As seguintes ideias podem ser inferidas do texto acima, exceto:

a) Função dos ácidos nucleicos.

b) Duplicação semiconservativa do material genético.

c) Mutação.

d) Seleção natural.

e) Reprodução sexuada e assexuada.

13. (PUC–MG) Suponha uma extensão de molde de DNA, com a seguinte sequência de desoxirribonucleotídeos: ATACGA. É incorreto afirmar:

a) Os códons especificados por essa sequência são UAUGCU.

b) Os anticódons complementares ao RNAm, produzidos por essa sequência, são AUACGA.

c) Os ribonucleotídeos, especificados por essa sequência, são TATGCT.

d) O fio de DNA complementar ao filamento dado é TATGCT.

e) Essa sequência codifica dois aminoácidos.

14. (PUC–SP) “No citoplasma, um conjunto de códons (I), ligado a ribossomas, complementa-se com anticódons (II), possibilitando a síntese de uma enzima.”.

No trecho acima, o processo sucintamente descrito e os componentes I e II são denominados, respectivamente:

a) Tradução, RNA mensageiro e RNA transportador.

b) Transcrição, RNA transportador e RNA mensageiro.

c) Transcrição, RNA mensageiro e RNA transportador.

d) Tradução, RNA ribossômico e RNA mensageiro.

e) Replicação, RNA ribossômico e RNA transportador.

15. (UEM) Sobre a expressão dos genes, assinale o que for correto.

01. As proteínas podem ser formadas por mais de uma cadeia polipeptídica.

02. Com os recursos da tecnologia do DNA recombinante, os cientistas conseguiram produzir o hormônio de crescimento humano em bactérias. Independentemente dos recursos tecnológicos utilizados, esse feito só foi possível porque o código genético das bactérias é idêntico ao código genético humano.

04. A sequência completa das bases do genoma é o código genético de uma espécie.

08. Nos organismos multicelulares adultos, as células são geneticamente idênticas, mas são encontrados muitos tipos de células diferenciadas, isto é, especializadas em diferentes funções. A forma e a função da célula dependem dos grupos de genes que entram em funcionamento ou que são desativados durante o desenvolvimento.

16. A síntese de uma molécula de DNA necessita de um molde que determina a sequência de bases da nova molécula. Na natureza, a regra é uma molécula de DNA servir de molde para a síntese de outro DNA. Os retrovírus constituem uma exceção, pois, na sua reprodução, o DNA é sintetizado a partir de um molde de RNA.

32. Na célula, as proteínas enzimáticas, ou enzimas, catalisam as reações químicas do anabolismo e as reações químicas do catabolismo.

64. Os anticorpos são produzidos por células sanguíneas nos vertebrados e por células foliares nas plantas fanerógamas.

Soma das alternativas corretas:

16. (UEMG) Vinokourov suspeito de doping na Volta à França.

O ciclista Alexandre Vinokourov, 33 anos, é suspeito de doping na Volta à França. Um exame efetuado no atleta, depois da sua vitória, detectou vestígios de dopagem com uma transfusão com sangue de um doador compatível. O laboratório antidoping de Paris detectou a presença de duas populações distintas de eritrócitos (glóbulos vermelhos) na amostra de sangue do atleta. Está correto afirmar que a descoberta de doping utilizando transfusão sanguínea só foi possível devido:

a) À análise de DNA nuclear dos eritrócitos encontrados no atleta.

b) À identificação de proteínas superficiais dos eritrócitos encontrados no atleta.

c) Ao número de cromossomos dos eritrócitos encontrados no atleta.

d) À ploidia mitocondrial dos eritrócitos encontrados no atleta.

17. (UEPG) O ácido desoxirribonucleico (DNA) é imprescindível para a hereditariedade. Com relação aos componentes da hereditariedade e a estrutura e função do DNA, assinale o que for correto.

01. Os cromossomos são formados por dois componentes principais: uma longa molécula de DNA e proteínas que lhes dão estrutura.

02. O DNA apresenta duas propriedades importantes: a autoduplicação e o armazenamento da informação genética.

04. Em 1953, Watson e Crick propuseram o modelo da estrutura do DNA conhecido atualmente.

08. Um erro de troca de bases nitrogenadas no mecanismo de duplicação do DNA consiste em uma mutação.

16. Uma mutação é sempre prejudicial, e jamais é importante para a variabilidade genética e evolução biológica.

Soma das alternativas corretas:

18. (UDESC) Analise as proposições quanto aos ácidos nucleicos.

I. O DNA é uma molécula constituída por duas cadeias de nucleotídeos dispostas em hélice, e apresenta as bases nitrogenadas adenina, guanina, timina e citosina.

II. O RNA é uma molécula formada por uma cadeia de nucleotídeos e apresenta as bases nitrogenadas adenina, guanina, timina e uracila.

III. O DNA plasmidial encontrado em bactérias se diferencia do DNA das células animais e vegetais porque não apresenta a base nitrogenada timina.

IV. O RNA mensageiro se diferencia do RNA transportador apenas por apresentar a base nitrogenada uracila no lugar da adenina.

Assinale a alternativa correta.

a) Somente a afirmativa I é verdadeira.

b) Somente as afirmativas I e II são verdadeiras.

c) Somente as afirmativas II e III são verdadeiras.

d) Somente as afirmativas I, III e IV são verdadeiras.

e) Somente a afirmativa IV é verdadeira.

19. (IFSul) Todos os seres vivos têm em comum o fato de suas informações hereditárias estarem armazenadas nas moléculas de ácidos nucleicos, que são de dois tipos básicos: DNA e RNA. A respeito dos ácidos nucleicos, são feitas algumas afirmações:

I. A molécula de açúcar que compõe os ácidos nucleicos é uma pentose.

II. Cada pentose, unida a um grupo fosfato e a uma base nitrogenada, forma um nucleotídeo.

III. O RNA apresenta uma combinação de quatro bases nitrogenadas, que se mantem pareadas formando uma fita dupla: citosina (C), guanina (G), adenina (A) e uracila (U).

Esta o corretas as afirmativas:

a) I, II, apenas.

b) I, III, apenas.

c) II, III, apenas.

d) I, II, III.

20. (UFU) O ácido desoxirribonucleico (DNA) é a molécula biológica que carrega as informações genéticas de um determinado organismo. Considere que o homem tenha um total de 6000 nucleotídeos, sendo 30% de Adenina. Assinale a alternativa que corresponde, respectivamente, à quantidade de bases Timina, Citosina e Guanina.

a) 1800; 1200; 1200.

b) 1200; 1800; 1200.

c) 1200; 1200; 1800.

d) 1400; 1400; 1400.

gab

 

Publicado por: Djalma Santos | 7 de outubro de 2015

TESTES DE MEIOSE (4/5)

01. (UFPI) “Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subsequente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel”.

(Walter S. Sutton, 1902).

O que Sutton achava possível sabe-se, hoje, ser verdade, isto é:

I. Os genes estão localizados nos cromossomos.

II. Dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes.

III. Dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente.

Sobre as afirmativas acima, pode-se dizer que:

a) Somente III está correta.

b) I e II estão corretas.

c) II e III estão corretas.

d) I e III estão corretas.

e) somente II está correta.

02. (UFGO) Relacione as etapas meióticas (coluna I), com os respectivos fenômenos (coluna II).

COLUNA I

1. Zigóteno.

2. Paquíteno.

3. Diplóteno.

4. Anáfase I.

5. Anáfase II.

COLUNA II

(  ) Migração dos cromossomos homólogos para os polos.

(  ) Pareamento de homólogos.

(  ) Migração dos cromossomos-irmãos  para  os  polos opostos.

(  ) Visualização dos quiasmas.

(  ) Ocorrência  de  crossing-over ou  permuta, entre cromátides homólogas.

A sequência correta, de cima para baixo, na coluna II é:

a) 4, 1, 2, 3, 5.

b) 4, 2, 5, 1, 3.

c) 4, 1, 5, 3, 2.

d) 4, 1, 3, 2, 5.

03. (CESGRANRIO) Nos processos de divisão celular o posicionamento dos cromossomas na metáfase e anáfase é importante porque garante:

a) Distribuição equitativa dos cromossomas pelas células filhas.

b) Pareamento cromossômico para a ocorrência do crossing-over.

c) Duplicação de DNA indispensável à continuidade do processo.

d) Formação de cromossomas homólogos e independentes.

e) Alinhamento de cromossomas necessário à formação de sinapses.

04. (UFSM) Analise as afirmativas a seguir.

I. No fim da meiose, as células-filhas são idênticas à célula-mãe, pois possuem o mesmo número de cromossomos.

II. Na interfase, ocorre duplicação do material genético.

III. A meiose é o processo pelo qual células diploides originam células haploides para a formação de gametas.

Está(ão) correta(s):

a) Apenas I.

b) Apenas II.

c) Apenas I e II.

d) Apenas I e III.

e) Apenas II e III.

05. (UNIRIO) A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. No homem, a meiose é gamética, e a fecundação reconstitui a diploidia. Qual dos pares de gametas representados abaixo poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino?

05

06. Qual dos seguintes processos não acontece durante a primeira divisão meiótica?

a) Redução do número de cromossomos.

b) Separação das cromátides-irmãs dos cromossomos homólogos.

c) Crossing over entre cromossomos homólogos.

d) Pareamento dos cromossomos homólogos.

07. (UNISINOS) O cruzamento cromossômico (crossing-over) é a troca de material genético entre cromossomos homólogos que ocorre durante a ___________ da ___________. Essa recombinação gênica forma células-filhas geneticamente ___________, que ___________ a variabilidade genética da espécie. Sobre o processo de divisão celular descrito acima, qual das alternativas abaixo preenche corretamente as lacunas?

a) prófase I; meiose; iguais; diminui

b) prófase II; mitose; diferentes; aumenta

c) prófase I; mitose; diferentes; aumenta

d) prófase I; meiose; diferentes; aumenta

e) prófase II; meiose; iguais; diminui

08. (UNISC) Nos eucariontes, durante a meiose:

a) O crossing-over ocorre na metáfase II.

b) O núcleo é dividido três vezes.

c) O núcleo é dividido apenas uma vez.

d) O DNA é replicado uma só vez.

e) As células tornam-se diploides.

09. (PUC-RIO) A banana cultivada (Musa x paradisiaca) é um caso típico de partenocarpia, ou seja, de formação de frutos sem que ocorra fecundação. Isso acontece por se tratar de uma planta triploide: as sementes não são formadas porque os gametas apresentam anormalidades no número de cromossomos. Em qual fase ocorre a distribuição anormal dos cromossomos?

a) Meiose I.

b) Meiose II.

c) Fase S da interfase da mitose.

d) Fertilização da oosfera.

e) Germinação do grão de pólen e formação dos gametas masculinos.

10. (UniEvangélica) Analise o esquema a seguir.

10

Disponível em: <http://www.sobiologia.com.br/conteudos/Citologia2/nucleo14.php&gt;.

Acesso em: 27 mar. 2014.

O esquema ilustra o resultado da meiose com ocorrência de crossing-over. O resultado final mostra quatro células com constituição genética distinta. Nesse sentido, conclui-se que:

a) As células produzidas no final do processo de crossing-over têm reconstituídos os cromossomos homólogos originais.

b) As quatro células-filhas têm a mesma constituição gênica e cromossômica da célula-mãe original.

c) Houve recombinação gênica, aumentando a variabilidade genética dos gametas resultantes.

d) Durante o crossing-over não há recombinação gênica, apenas troca de segmentos cromossômicos.

11. (IFSC) A figura abaixo representa uma célula germinativa de um organismo hipotético. Considere que a célula se encontra na metáfase da meiose I. Cada letra de A a G representa um gene em seu respectivo locus gênico. Os diferentes alelos são diferenciados por letras maiúsculas ou minúsculas.

11

Assinale a soma da(s) proposição(ões) correta(s).

01. A célula é diploide e apresenta um total de quatro cromossomos na forma duplicada.

02. Não ocorrendo mutações, as cromátides irmãs deverão necessariamente apresentar os mesmos genes alelos.

04. O indivíduo representado é homozigoto para os genes A e g.

08. Após o término da meiose II serão formadas duas células cada uma com dois cromossomos na forma duplicada.

16. A célula apresenta dois pares de cromossomos homólogos.

32. Não ocorrendo mutações genéticas durante a meiose, todos os gametas formados por esse indivíduo serão iguais.

Soma das alternativas corretas:

12. (UEL) Observe o esquema, que representa um tipo de divisão celular.

12

Sobre esse processo, assinale a alternativa correta.

a) A célula A é diploide e as células B e C são haploides.

b) Trata-se de uma mitose.

c) As células A e B são diploides e as células C são haploides.

d) A redução no número de cromossomos ocorre durante a etapa 2.

e) O processo se relaciona com a formação de gametas nos vegetais.

13. (IFMG) Um dos principais fatores evolutivos das espécies é a recombinação genética. Um dos fenômenos que aumenta a taxa de recombinação é a permutação ou crossing-over que:

a) Ocorre na Prófase II da meiose.

b) Pode ocorrer em qualquer parte das cromátides homólogas.

c) Ocorre na formação das células somáticas.

d) Ocorre entre cromátides irmãs.

14. Durante uma determinada fase da meiose, estruturas em forma de X são visíveis citologicamente em cromossomos homólogos e são denominadas quiasmas. A figura abaixo representa cromossomos com quiasmas. Observe-a.

14

Considerando a figura e o assunto relacionado com ela, analise as afirmativas abaixo e assinale a alternativa correta.

a) Nos cromossomos representados, ainda não ocorreu “crossing-over”.

b) Esse tipo de estrutura é visualizado somente na anáfase I.

c) Nas fêmeas humanas, os quiasmas formam-se na fase intrauterina.

d) Os quiasmas ocorrem entre cromátides irmãs.

15. (FUVEST) Os produtos imediatos da meiose de uma abelha e de uma samambaia são:

a) Esporos e gametas, respectivamente.

b) Gametas e esporos, respectivamente.

c) Gametas e zigotos, respectivamente.

d) Ambos esporos.

e) Ambos gametas.

16. (PUC-SP) Analise os ciclos de vida abaixo:

16

Com relação aos ciclos, é incorreto afirmar que:

a) No ciclo I ocorre meiose gamética.

b) No ciclo II ocorre meiose espórica.

c) Nos ciclos I e II a formação dos indivíduos diploides a partir do zigoto ocorre por mitose.

d) O ciclo II é apresentado por certas algas, plantas e pela maioria dos animais.

e) O ciclo I é apresentado pela espécie humana.

17. (FCM-PB) Em relação ao processo meiótico, assinale V (verdadeira) ou F (falsa) para as proposições abaixo e assinale a alternativa correspondente à sequência correta.

I. A meiose é a divisão celular que ocorre nas células germinativas, a fim de originar os gametas masculinos e femininos.

II. É no crossing-over, evento crítico da meiose I, que ocorre a permuta dos segmentos das cromátides entre os cromossomos homólogos pareados.

III. É na prófase I, subfase diacinese, que ocorre a formação do complexo sinaptonêmico.

IV. Os quiasmas desempenham um papel importante no controle da segregação dos cromossomos.

V. A prófase II é a fase mais longa e mais complexa da meiose.

a) V, F, V, F, F.

b) F, V, V, V, F.

c) V, V, V, F, F.

d) V, V, F, V, F.

e) F, V, F, V, F.

18. (UNIOESTE) Considere as associações abaixo sobre as fases da meiose e suas características.

18

Assinale a alternativa cujas associações estão todas corretas.

a) II, V, VI.

b) II, IV, VI.

c) II, III, VI.

d) I, III, V.

e) I, V, VI.

19. Os ciclos de vida dos seres vivos variam quanto ao momento de ocorrência da meiose. Toda meiose é obrigatoriamente reducional, formando quatro células filhas haploides, a partir de duas divisões consecutivas, conforme ilustrado na figura.

19

A diferença entre mamíferos e angiospermas, com relação às células produzidas pela meiose, consiste basicamente no fato de que nos mamíferos esse processo ocorre para formação de:

a) Espermatogônias e ovogônias, enquanto nas angiospermas para formação do androceu e gineceu.

b) Gametas masculinos e femininos, enquanto nas angiospermas para formação de esporos masculinos e femininos.

c) Gônadas masculinas e femininas, enquanto nas angiospermas para formação de gametas masculinos e femininos.

d) Espermatozoides e óvulos, enquanto nas angiospermas para formação de anterozoides e oosferas.

20. (UniEvangélica) Analise o esquema a seguir, considerando a exemplificação de um par de cromossomos homólogos humanos que passaram pela meiose.

20

Se uma não disjunção como exemplificada acima ocorrer em uma ovogênese e o óvulo 3 for fecundado por um espermatozoide normal, o resultado será um organismo:

a) Euploide 3n + 1.

b) Aneuploide trissômico.

c) Euploide triploide.

d) Aneuploide dissômico.

gasb

 

« Newer Posts - Older Posts »

Categorias

Seguir

Obtenha todo post novo entregue na sua caixa de entrada.

Junte-se a 575 outros seguidores