Publicado por: Djalma Santos | 18 de maio de 2017

TESTES DE EMBRIOLOGIA (6)

01. (UENP) Com base nos conhecimentos sobre embriologia, atribua V (verdadeiro) ou F (falso) às afirmativas a seguir.

( ) No estágio de gástrula, na maioria das espécies, os blastômeros reorganizam-se em três conjuntos de células: ectoderma, mesoderma e endoderma.

( ) A placenta é um anexo embrionário que elimina gás carbônico e excreções do embrião.

( ) A gestação de gêmeos ocorre quando um ovócito é fecundado por dois espermatozoides.

( ) Nidação é o processo de implantação do embrião no útero.

( ) A ação da gonadotrofina coriônica no corpo-amarelo ovariano mantém elevadas as taxas de estrógeno e progesterona no sangue da gestante.

Assinale a alternativa que contém, de cima para baixo, a sequência correta.

a) V, V, F, F, F.

b) V, F, V, F, F.

c) V, F, F, V, V.

d) F, V, V, F, V.

e) F, F, V, V, F.

02. (UNICENTRO)

Estudando o desenvolvimento embrionário, um aluno se deparou com a imagem destacada. Analisando-a atenciosamente e com os conhecimentos sobre o assunto, é possível afirmar:

a) A fase embrionária, em destaque, ocorre imediatamente após a blastulação.

b) Ela pode ser encontrada em todos os triblásticos.

c) O tubo neural, em destaque, é originado do sistema nervoso.

d) Ela não possui a formação dos somitas nem de músculos.

e) A notocorda pode ser usada como critério taxonômico.

03. (UEL) Observe a charge a seguir e responda esta questão.

Na charge, existe a dúvida do que é esquerda e do que é direita, porém um dos mais importantes fenômenos do processo embrionário dos animais é o desenvolvimento dos três eixos corporais, entre os quais o eixo direito esquerdo. Com raras exceções, todo embrião animal desenvolve esses eixos embrionários, que definem a estrutura corporal do futuro organismo. Assinale a alternativa que apresenta, corretamente, em que momento, nos seres humanos, o eixo direito-esquerdo é definido durante o desenvolvimento embrionário.

a) Durante a fase de clivagem.

b) Durante a formação da blástula.

c) Na gastrulação.

d) Na histogênese.

e) No estágio de mórula.

04. (UEM) Durante a fase do desenvolvimento embrionário humano, ocorre a diferenciação e a especialização de funções das células que formarão os tecidos do indivíduo. Sobre este assunto, assinale a(s) alternativa(s) correta(s).

01. Nos humanos, o primeiro tecido a ser formado no período da gástrula é a mesoderme, que originará a epiderme.

02. Todas as células do organismo se originam a partir da célula ovo ou zigoto e são diferenciadas uma das outras devido à meiose que ocorre no período embrionário.

04. A diferenciação e a especialização de funções gera maior eficiência às células e aos tecidos, entretanto gera também uma interdependência e, desta forma, a necessidade de comunicação entre elas.

08. A pele humana é um exemplo de tecido epitelial de revestimento.

16. A matriz extracelular componente dos tecidos é produzida pelos lisossomos e pelos peroxissomos das células do próprio tecido.

Soma das alternativas corretas:

05. (PUC-CAMPINAS) Os embriões de certos animais, I e II, no interior de ovos com casca, produzem amônia, que é transformada em ácido úrico armazenado em uma estrutura denominada III. A frase acima estará correta se I, II e III forem, respectivamente, substituídos por:

a) anfíbios, répteis e cório.

b) anfíbios, répteis e alantoide.

c) répteis, aves e cório.

d) répteis, aves e alantoide.

e) aves, mamíferos e âmnio.

06. (UEPG) O esquema representativo a seguir descreve etapas do desenvolvimento do anfioxo. Sobre o assunto, assinale o que for correto.

Adaptado de: Linhares, S.; Gewandsznajder, F. Biologia hoje.

15a ed. Volume 1. Editora Ática. São Paulo, 2010.

01. A segmentação do anfioxo é holoblástica e igual. A mórula (A) transforma-se em blástula (B), que sofre invaginação e origina a gástrula (C), resultando em duas camadas de células, a ectoderme (1) e a endoderme (3).

02. A partir da endoderme (7), formam-se as glândulas, o sistema nervoso e os músculos.

04. Nos protostômios, o blastóporo (2) origina a boca e, nos deuterostômios, origina o ânus.

08. D = gástrula; 5 = tubo neural; 6 = notocorda; 7 = pulmões; 8 = boca.

16. O tubo neural (6) e a notocorda (5) formam-se apenas nos cordados. Nos vertebrados, a notocorda é substituída pela coluna vertebral e o tubo neural origina o sistema nervoso.

Soma das alternativas corretas:

07. (Unitau) O gameta feminino, além de carregar o material genético da fêmea, pode carregar outros componentes, como proteínas, ribossomos, RNAs e vitelo, dentre outras moléculas. A posição e a distribuição do vitelo nos ovos são utilizadas como itens na classificação dos tipos de ovos produzidos pelos indivíduos das espécies. Assinale a alternativa que relaciona corretamente o tipo de ovo com o grupo de animais, além do padrão de quantidade e de distribuição do vitelo existente no ovo.

08. (PUC-SP) Observe atentamente a ilustração a seguir, que representa diversos estágios do desenvolvimento de um sapo.

Na ilustração acima, segmentação, neurulação e gametogênese ocorrem, respectivamente, nas etapas representadas pelos algarismos:

a) I, III e V.

b) V, VI e I.

c) II, III e IV.

d) II, IV e VI.

09. (CATÓLICA SC)

Leia o texto a seguir. Cientistas criam “miniestômagos” em laboratório

Eles serão uma importante ferramenta para pesquisas sobre doenças como úlcera, câncer ou diabetes, além de testar a reação do órgão a medicamentos A partir de células-tronco, cientistas criaram os primeiros “miniestômagos” em laboratório. São pequenos aglomerados de tecido gástrico que contêm células em estágio inicial, como uma versão em miniatura do estômago. Essa será uma importante ferramenta para auxiliar em pesquisas sobre doenças como úlcera, câncer ou diabetes, além de testar a reação do órgão a medicamentos. O estudo, descrevendo como os cientistas fabricaram o tecido, foi publicado nesta quarta-feira na revista Nature. “Até agora, não havia uma forma adequada de estudar doenças estomacais em humanos”, afirmou o médico Jim Wells, do Centro Médico do Hospital Infantil de Cincinnati, em Ohio, e líder do estudo. “O estômago humano é muito diferente do de outros animais. As células diferenciadas e sua estrutura e arranjo nos nossos tecidos estomacais desenvolvidos em laboratório foram virtualmente idênticos ao que encontraríamos normalmente no estômago”, prosseguiu. Por ter o desenvolvimento embrionário igual ao humano, o tecido in vitro é melhor que o modelo animal de ratos, usado até então. Essa etapa é fundamental para identificar processos bioquímicos relacionados a doenças como obesidade ou diabetes.

Adaptado de: . Acesso em: 22/11/14.

Suponha que os embriões de onde as células foram retiradas para a construção desse “miniestômago” já possuíam os três tecidos embrionários. Assinale a afirmativa que mostra o(s) tecido(s) que poderia(m) ser utilizado(s).

a) A ectoderme.

b) A endoderme.

c) Tanto a ectoderme quanto a endoderme.

d) A mesoderme.

e) Tanto a mesoderme quanto a ectoderme.

10. (UFAM) Durante o desenvolvimento embrionário, algumas estruturas endócrinas derivam a partir do tecido nervoso. Assinale a alternativa que apresenta estas estruturas:

a) Ovário e timo.

b) Pâncreas e fígado.

c) Estômago e coração.

d) Tireoide e testículos.

e) Medula adrenal e hipófise posterior.

11. (UEA) Ao longo do desenvolvimento embrionário dos vertebrados, algumas fases se caracterizam pelo arranjo e diferenciação celular das estruturas do embrião. No desenvolvimento embrionário, há mais células diferenciadas:

a) na blástula do que na nêurula.

b) na mórula do que na blástula.

c) na nêurula do que na blástula.

d) na gástrula do que na nêurula.

e) na mórula do que na gástrula.

12. (FACTO) Os embriões possuem um conjunto de membranas que não fazem parte do corpo e não originam nenhuma estrutura do organismo, sendo denominados anexos embrionários. Em relacao ao ser humano, responda nos itens abaixo a única resposta correta sobre os anexos embrionários.

a) O âmnio e uma membrana que recobre o embrião, apresentando função protetora contrachoques mecânicos e desidratação.

b) O cório participa da alimentação, circulação e excreção do embrião e origina-se do saco vitelínico e do alantoide, sendo envolvido pelo âmnio.

c) No alantoide são formadas as celulas sanguíneas no começo do desenvolvimento, onde posteriormente diminui seu tamanho até desaparecer.

d) O saco vitelino e a membrana mais externa, que ajuda na implantação do embrião no útero.

e) A placenta e uma fina membrana originada entre a ectoderme e a mesoderme, sendo preenchida pelo líquido amniótico, ocorrendo também em aves e repteis.

13. (IFMT)

CIENTISTAS OBTÉM VISÃO INÉDITA DE INÍCIO DA VIDA EM EMBRIÕES

Cientistas do Reino Unido e Estados Unidos criam embriões humanos de duas semanas em laboratório pela primeira vez, simulando quimicamente o ambiente do útero. O estudo permitiu que pesquisadores observassem em embriões com dez dias a formação do epiblasto, uma aglomeração bem pequena e crucial de células, enquanto as células ao seu redor se encarregam dos anexos embrionários.

(Disponível em: http://noticias.terra.com.br/ciencia/cientistas-obtem-visao-inedita-de-inicio-da-vida-em-embrioes,5ab130676efbb56a0ed55f001d6813f3j0edqowe.html. Acessado em ago. 2016).

Com relação à temática apresentada no texto, assinale a afirmativa correta.

a) A implantação do embrião no útero, ocorre imediatamente após a formação do zigoto.

b) O epiblasto está diretamente relacionado à formação da cavidade amniótica do âmnio.

c) O epiblasto é formado na fase do desenvolvimento embrionário, denominado organogênese.

d) O espessamento do endométrio é mantido por ação do hormônio folículo estimulante.

e) Os primeiros anexos embrionários formados são o alantoide, a placenta e o saco vitelínico.

14. (UFPR) Um biólogo mensurou a massa de componentes do ovo de um réptil durante seu desenvolvimento, desde o dia da postura até o momento da eclosão. Ao longo das medidas, o que se espera que tenha ocorrido, respectivamente, com a massa do embrião, do vitelo e do alantoide?

a) Aumento – redução – aumento.

b) Aumento – aumento – redução.

c) Aumento – redução – redução.

d) Redução – redução – aumento.

e) Redução – aumento – redução.

15. (UNIOESTE) Com relação ao desenvolvimento embrionário dos animais, assinale a alternativa correta.

a) Os amniotas que possuem o anexo embrionário denominado âmnio são os anfíbios, os répteis, as aves e os mamíferos.

b) Nos vertebrados, a ectoderma dará origem ao sistema nervoso central e a notocorda dará origem à coluna vertebral.

c) Os animais diblásticos são caracterizados por possuírem dois folhetos germinativos: a ectoderma e a mesoderma.

d) Na segmentação holoblástica desigual há a formação de micrômeros no polo animal e macrômeros no polo vegetativo.

e) Todos os animais triblásticos são celomados, ou seja, possuem cavidade corporal totalmente revestida por mesoderma.

16. (UEPG) O embrião dos répteis e das aves está protegido por um ovo com casca. Os anexos embrionários auxiliam o desenvolvimento do embrião. Assinale o que for correto sobre as características destas estruturas.

01. O córion tem função excretora, permitindo a eliminação do excesso de ureia presente nos embriões de aves. Além disso, por ser o anexo mais externo, também protege o embrião contra choques mecânicos.

02. O alantoide recebe as excretas do embrião, retira oxigênio do ar, elimina gás carbônico, e ainda, retira cálcio da casca do ovo.

04. O saco vitelínico participa de eventos de trocas gasosas entre o meio ambiente e o embrião, principalmente por meio de poros existentes na casca de ovos de repteis e aves.

08. O âmnio contém um líquido que protege o embrião contra choques mecânicos e evita o seu dessecamento. Essa estrutura foi importante para a conquista do ambiente terrestre pelos répteis, pois permitiu o desenvolvimento embrionário fora do ambiente aquático.

Soma das alternativas corretas:

17. (UNICENTRO) Entre os animais, podem-se encontrar ovos oligolécitos e ovos telolécitos. A quantidade e a distribuição de vitelo presentes nesses dois tipos de ovos são responsáveis pela diferença no desenvolvimento embrionário dos animais. Assinale a alternativa que apresenta, corretamente, a característica do desenvolvimento embrionário determinada por essa diferença.

a) Tipo de clivagem.

b) Presença de celoma.

c) Presença de notocorda.

d) Presença de tubo neural.

e) Número de folhetos embrionários.

18. (UPF) Durante o desenvolvimento embrionário de répteis, aves e mamíferos, formam-se estruturas especiais que derivam dos folhetos embrionários, mas que não fazem parte do corpo do embrião: são os anexos embrionários. Assinale, entre as alternativas a seguir, aquela que apresenta o anexo embrionário e sua respectiva função, que permitiu aos animais terrestres citados desenvolverem seus embriões fora do ambiente aquático.

a) Córion – possibilitar as trocas gasosas entre o embrião e o meio.

b) Âmnio – proteger o embrião contra a dessecação e choques mecânicos.

c) Placenta – realizar trocas de substâncias entre o embrião e a mãe.

d) Saco vitelínico – armazenar nutrientes para o embrião.

e) Alantoide – armazenar as excreções produzidas pelo embrião.

19. (UFU) As figuras a seguir representam o processo das clivagens iniciais do desenvolvimento embrionário em três organismos diferentes (I, II e III).

Qual alternativa apresenta a associação correta entre os processos de clivagens e o organismo correspondente?

a) I – répteis; II – mamíferos; III – peixes.

b) I – anfíbio; II – aves; III – artrópodes.

c) I – artrópodes; II – répteis; III – aves.

d) I – aves; II – artrópodes; III – mamíferos.

20. (UFLA) A lubrificação da superfície fetal de um mamífero é feita pelo líquido presente no:

a) Cório.

b) Âmnio.

c) Alantoide.

d) Saco vitelino.

 

Publicado por: Djalma Santos | 18 de maio de 2017

TESTES DE REPRODUÇÃO (11)

01. (Unitau) A metagênese, ou alternância de gerações, é uma estratégia do ciclo de vida nas classes Hydrozoa e Scyphozoa. Esse tipo de ciclo envolve uma fase de reprodução assexuada, que não inclui a recombinação genética, e outra fase sexuada, quando há a recombinação gênica. Para os cnidários, a alternância de gerações é diferente da observada entre as plantas e algas multicelulares, uma vez que, nos Cnidaria, ambas as gerações são diploides. Assinale apenas a alternativa que apresenta informações corretas acerca da metagênese dos cnidários e das características de Hydrozoa e de Scyphozoa.

a) No ciclo de vida dos Hydrozoa, a medusa é a forma predominante e a sua medusa jovem é chamada de Éfira.

b) No ciclo de vida dos Hydrozoa, o pólipo é a forma predominante e a sua medusa jovem é chamada de Éfira.

c) No ciclo de vida dos Scyphozoa, a medusa é a forma predominante e a sua medusa jovem é chamada de Éfira.

d) A estrobilação é a reprodução assexuada mais frequente nos cnidários, e a larva plânula é exclusiva dos Hydrozoa.

e) A estrobilação é a reprodução assexuada mais frequente nos Hydrozoa, e a larva plânula é ciliada, livre natante e exclusiva desse grupo.

02. (UNICENTRO)

Em relação à imagem destacada e com base nos conhecimentos a respeito do ciclo reprodutivo da mulher, é correto afirmar:

a) O início do ciclo prescinde da secreção do hormônio hipotalâmico liberador de gonadotrofinas (GnRH).

b) Por ação do folículo estimulante, há uma redução do folículo ovariano.

c) O estrógeno estimula o desenvolvimento do folículo ovariano.

d) Na fase lútea, o corpo amarelo secreta progesterona que proporcionará o desenvolvimento do endométrio.

03. (UDESC) “Os mais famosos gêmeos monozigóticos unidos foram os irmãos Chang e Eng, nascidos em 1811 na atual Tailândia (antigo Sião), que eram ligados pela região torácica. Eles ficaram conhecidos como “irmãos siameses” e ganharam a vida exibindo-se para plateias nos Estados Unidos, onde moraram e se casaram com duas irmãs”. Texto extraído de Biologia das Células; Amabis e Martho, Vol. 1, 2ª ed., Moderna, p. 426. Os gêmeos monozigóticos são originados:

a) pela fecundação de dois óvulos por um espermatozoide.

b) de um único óvulo fecundado por um espermatozoide.

c) pela fecundação de dois óvulos cada um por um espermatozoide.

d) quando um óvulo é fecundado por dois espermatozoides.

e) quando a ovogônia é fecundada.

04. (PUCPR) Leia o texto a seguir:

Os irmãos xifópagos e a teoria do Direito penal: uma discussão pela Filosofia do Direito

Dentre os escritos dos doutrinadores de Direito Penal é possível encontrar a figura dos gêmeos xifópagos para exemplificar casos difíceis, em especial para o crime de homicídio. A alusão a esses gêmeos, muito raros na realidade, como vítimas ou agentes do homicídio, não ocorre apenas nos livros, mas também em muitas aulas de Direito Penal. O recurso não parece ser apenas retórico, buscando chamar a atenção dos leitores/alunos, pois há um grande incômodo com o fato desses gêmeos, que vai além da curiosidade e do bizarro. O incômodo dos doutrinadores e professores parece estar no fato de os gêmeos xifópagos estarem grudados um ao corpo do outro. Isso leva à discussão de um dogma do Direito, que é a individualização da pena e da sanção individual de reclusão. O Direito Penal, como outros direitos ocidentais, tem como principal pilar a penalização do indivíduo. Porém, os gêmeos xifópagos colocam em questão esse fundamental pilar, pois a sua existência coloca em questão o que é que caracteriza um indivíduo para o direito.

Disponível em: <http://www.ambitojuridico.com.br/site/?n_link=revista_artigos_leitura&artigo_id=9642&revista_caderno=15&gt;. Acesso em: 9 fev. de 2016.

Considerando o conceito unicamente biológico, xifópagos são indivíduos genotipicamente únicos, uma vez que:

a) surgem de dois óvulos fecundados por um espermatozoide.

b) surgem da fusão tardia de dois embriões com genótipos diferentes.

c) se originam da fecundação de um óvulo por um espermatozoide.

d) resultam da não disjunção dos cromossomos homólogos durante a meiose reducional.

e) são formados pela fecundação de um óvulo por dois espermatozoides.

05. (UCS) O processo de espermatogênese envolve uma série de divisões mitóticas e meióticas necessárias para que, a partir de uma célula embrionária, sejam originadas as células germinativas. Durante a espermatogênese, formam-se as espermatogônias, os espermatócitos I e os espermatócitos II, as espermátides e as células finais, que são os espermatozoides.

Assinale a alternativa que relaciona corretamente os números apresentados na figura acima, com a carga genética de cada célula do processo espermatogênico.

06. (Mackenzie) O esquema abaixo representa o aparelho reprodutor feminino humano.

Assinale a alternativa correta.

a) O FSH é um hormônio que age no órgão A enquanto que o LH age no órgão C.

b) O órgão C é responsável por abrigar o embrião durante o desenvolvimento e também por ser o local onde ocorre a fecundação.

c) O estrógeno é um hormônio produzido no órgão A e tem como função provocar o espessamento da camada interna do órgão C.

d) A laqueadura é um método que consiste na obstrução do órgão D.

e) No período fértil é quando a parede interna do órgão D se encontra mais espessada.

07. (UFLA) A capacidade de um organismo gerar novos indivíduos semelhantes a si mesmo é chamada de reprodução, podendo ser assexuada ou sexuada. Na reprodução assexuada, um único indivíduo genitor dá origem a descendentes geneticamente idênticos ao genitor. O processo de reprodução assexuada, que ocorre em planária, platelmintos e equinodermas, em que partes do corpo do genitor se destacam e dão origem a novos indivíduos denomina-se:

a) Brotamento.

b) Esporulação.

c) Fragmentação.

d) Divisão binária.

08. (UFJF) Sobre o tipo de reprodução que os organismos realizam, marque (V) para afirmativas Verdadeiras e (F) para as Falsas.

I. O paramécio, um organismo unicelular eucarionte, se reproduz assexuadamente por bipartição.

II. Bactérias, assim como as hidras, se reproduzem por brotamento ou gemiparidade.

III. Alguns animais podem se reproduzir por fragmentação, onde o corpo do animal se parte em dois ou mais pedaços e cada pedaço origina um novo indivíduo.

IV. Minhocas e abelhas são exemplos de animais que podem realizar a fecundação recíproca ou fecundação cruzada, pois são hermafroditas.

IV. Conjugação é um tipo de “reprodução” onde os organismos unicelulares podem trocar material genético entre si.

Assinale a alternativa correta sobre as afirmativas anteriores:

a) (I) V, (II) F, (III) V, (IV) F, (V) V.

b) (I) V, (II) V, (III) V, (IV) F, (V) V.

c) (I) F, (II) F, (III) V, (IV) V, (V) V.

d) (I) V, (II) F, (III) V, (IV) V, (V) F.

e) (I) V, (II) V, (III) V, (IV) F, (V) F.

09. (Unimontes) A imagem abaixo mostra resumidamente um método de esterilização masculina.

Com base no processo referente à imagem, é correto afirmar:

a) Passada a intervenção cirúrgica e completada a fase de recuperação, a produção de sêmem continua.

b) Os espermatozoides, após o procedimento cirúrgico, ficam confinados na próstata, e somente alguns deles alcançam a uretra.

c) A produção de testosterona é diminuída gradativamente após a cirurgia, o que pode diminuir a libido do homem.

d) Como a testosterona diminui, a secreção do hormônio liberador de gonadotrofinas pelo hipotálamo é aumentada no sentido de compensar os efeitos da queda da testosterona.

10. (UERJ) A reprodução em animais do sexo masculino envolve uma série de divisões celulares, que produzem espermatócitos primários e secundários como etapas intermediárias para a produção dos gametas masculinos. Considere um macho adulto diploide que apresenta 28 cromossomos em suas células somáticas. Nesse caso, seus espermatócitos primários e seus espermatócitos secundários devem conter, respectivamente, os seguintes números de cromossomos:

a) 28 – 14.

b) 14 – 28.

c) 28 – 28.

d) 14 – 14.

11. (UEMG) Analise a representação gráfica do ciclo ovariano regular de 28 dias, mostrado a seguir.

O hormônio 4 tem como função:

a) liberar o ovócito II.

b) estimular a libido feminina.

c) desenvolver o folículo ovariano.

d) aumentar a espessura do endométrio.

12. (Unisinos) Alguns organismos na natureza possuem dois tipos de reprodução: sexuada e assexuada. Por exemplo, em bactérias, ocorre um processo em que uma célula se divide em duas e origina duas células geneticamente idênticas. Esse caso de reprodução assexuada é chamado de:

a) brotamento.

b) cissiparidade.

c) regeneração.

d) metagênese.

e) esporulação.

13. (FATEC) No Brasil, as mulheres assalariadas têm assegurado o direito a uma licença de 120 dias, período durante o qual podem amamentar regularmente seus filhos. No entanto, e recomendável que as empresas busquem meios de permitir que suas funcionárias estendam o período da licença. Isso porque, além dos propósitos afetivo e social, a amamentação é uma adaptação biológica importante para os mamíferos em geral, já que ela:

a) garante que as gêmeas engravidem novamente sem que ocorra ovulação.

b) garante que o filhote possa chegar a fase adulta sem doenças autoimunes.

c) fornece as organelas citoplasmáticas, que formarão a bainha de mielina do filhote.

d) fornece antígenos maternos, que permitem a digestão enzimática dos cátions Ca2+.

e) fornece ao filhote anticorpos maternos, que fortalecem o sistema imune dele.

14. (IFNMG) Analise a figura abaixo.

Em relação ao desenvolvimento embrionário e ao processo evidenciado na figura é correto afirmar que:

a) os grânulos corticais são responsáveis pela reação zonal que impede a penetração de outro espermatozoide no óvulo a partir da liberação de enzimas hidrolíticas que destroem os receptores ZP3.

b) a corona radiata é degradada logo após a fecundação por enzimas proteolíticas secretadas pelo zigoto ainda na porção distal da tuba uterina.

c) após o contato dos espermatozoides com a zona pelúcida, o ovócito II termina a segunda divisão meiótica e origina o óvulo.

d) o acrossomo presente no espermatozoide é produzido durante a espermiogênese a partir do retículo endoplasmático liso.

15. (UFAM) Que tipo celular é a fonte primária de produção de testosterona nos homens, promovendo a espermatogênese nos túbulos seminíferos?

a) Células de Sertoli.

b) Espermatogônia.

c) Células de Leydig.

d) Espermatócito primário.

e) Espermatozoide.

16. (UEA) No homem, a última etapa da gametogênese é a espermiogênese, durante a qual ocorre a maturação do espermatozoide, formando o acrossomo. O acrossomo:

a) armazena o material genético que se fundirá com o núcleo do ovócito II.

b) expulsa o excedente de água que entra no espermatozoide.

c) fornece energia para o movimento do espermatozoide.

d) contém enzimas que digerem o envoltório do ovócito II.

e) armazena o vitelo que se unirá com o citosol do ovócito II.

17. (UECE) Em setembro de 2016, a revista New Scientist divulgou o nascimento do primeiro bebê gerado a partir do DNA de três pessoas. Os óvulos, com DNA nuclear da mãe e DNA mitocondrial da doadora, foram fertilizados com espermatozoides do pai e um dos cinco embriões resultantes foi injetado dentro do útero da mãe.

Fonte: https://www.newscientist.com/article/2107219-exclusive-worlds-first-baby-born-with-new-3-parenttechnique/

Em relação à reprodução humana, é correto afirmar que:

a) os testículos ficam localizados dentro de uma bolsa, o escroto, para que sua temperatura seja mais elevada do que a do restante do corpo, condição ideal para produção dos espermatozoides.

b) no ciclo uterino, que ocorre paralelamente ao ciclo ovariano, acontece o espessamento do endométrio e, caso não ocorra a fertilização, sua descamação ocasiona a menstruação.

c) a ovulogênese corresponde à formação dos gametas femininos enquanto a espermatogênese representa a formação dos espermatozoides, processos que ocorrem a partir da puberdade.

d) dos métodos que previnem a gravidez, denominados contraceptivos, os mais efetivos são a tabelinha, a lavagem vaginal e o coito interrompido (retirada do pênis antes da ejaculação).

18. (FPS) O desenvolvimento embrionário, nos mamíferos placentários, envolve várias etapas. Contudo, é incorreto afirmar que:

a) o óvulo representa um ovócito secundário estacionado na metáfase I da meiose.

b) o ovócito secundário é liberado do ovário revestido por um envoltório chamado “zona pelúcida”.

c) a gravidez geralmente decorre da fecundação do ovócito na porção superior do oviduto.

d) após a fecundação, a meiose completa-se gerando o zigoto.

e) a segmentação nos mamíferos placentários é holoblástica e igual.

19. (IFMT)

Tomando como referências os textos acima, é correto afirmar que o tipo de reprodução realizado pelas espécies ilustradas neles contidas, baseia-se:

a) na formação de brotos que, ao se separarem do corpo do genitor, passam a ter vida independente, constituindo novos indivíduos.

b) na liberação de gametas do macho ou da fêmea no ambiente que se multiplicam por meio de sucessivas divisões celulares originando um novo ser geneticamente idêntico aquele que o produziu.

c) no desenvolvimento do gameta feminino formando um novo indivíduo sem que haja fecundação.

d) no desenvolvimento de pedaços do corpo de um dos genitores que por mitose forma filhote.

e) no desenvolvimento do gameta masculino, originando um novo ser sem que haja necessidade de encontrar o gameta feminino.

20. (UNIPAR) A placenta, estrutura que contém tecidos da mãe e do embrião, permite que o organismo materno forneça oxigênio e nutrientes, recolhendo, também, os resíduos do metabolismo do embrião. Em condições normais, o mecanismo de trocas materno-fetal ocorre:

a) Por livre difusão, em que a oxigenação, nutrição e remoção de excretas são feitas através de trocas entre a circulação fetal e materna.

b) Pelo líquido da bolsa d’água, que recebe os nutrientes e oxigênio do sangue materno, difundindo-os até o sangue do embrião.

c) Por transporte ativo, em que o sangue do embrião atrai os nutrientes e o oxigênio do sangue materno.

d) Pela ação de hormônios gonadotróficos, que fazem o transporte dos elementos do sangue materno para o fetal.

e) Por uma circulação única materno-fetal, isto é, o sangue da mãe entra em contato direto com o do embrião.

Publicado por: Djalma Santos | 18 de maio de 2017

TESTES DE ZOOLOGIA (19)

01. (UPE) Observe a figura com os cortes transversais do corpo de animais triblásticos (representados por números romanos; os números em arábico correspondem aos folhetos embrionários e às cavidades) e alguns exemplares (representados por letras).

Assinale a alternativa que apresente a correta correspondência entre os cortes, seu detalhamento e os exemplos de animais.

a) I-acelomado; 1-endoderma, 2-mesoderma, 3-celoma, 4-ectoderma; os anelídeos o representam em B – minhoca.

b) I-celomado; 1-endoderma, 2-mesoderma, 3-celoma, 4-ectoderma; os cordados o representam em A – nematelminto.

c) II- acelomado; 1-endoderma, 2-mesoderma, 3-ectoderma; os platelmintos os representam em C – planárias de água doce.

d) II- pseudocelomado; 1-endoderma, 2-pseudoceloma, 3- mesoderma; os nematódeos os representam em B – tênias ou solitárias.

e) III- pseudocelomado; 1-ectoderma, 2-pseudoceloma, 3- mesoderma, 4- endoderma; os hirudíneos o representam em A – sanguessuga.

02. (UNICENTRO) O blastóporo constitui-se um poro que surge no desenvolvimento embrionário de animais, em processo denominado de gastrulação. Essa característica permite dividir os metazoários em dois grandes grupos. Nos protostomados, a boca embrionária deriva do blastóporo. Nos deuterostomados, a boca apresenta uma origem secundária. São exemplos de protostomados e deuterostomados, respectivamente,

a) minhoca e ostra.

b) aranha e lesma.

c) ouriço-do-mar e anfioxo.

d) caramujo e estrela-do-mar.

03. (UEPG) Em relação a algumas características evolutivas na fisiologia animal, assinale o que for correto.

01. Os peixes de grande porte possuem respiração cutânea, fazendo as trocas gasosas com o ambiente pela superfície corporal.

02. Nos artrópodes, o sistema circulatório é aberto, já que os vasos têm as extremidades abertas e o fluido (hemolinfa) passa para as cavidades corporais, as hemocelas (ou lacunas), entrando em contato direto com os tecidos para a troca de substâncias.

04. As aves apresentam algumas especializações do tubo digestivo como o papo, especializado no armazenamento e umedecimento do alimento, além da moela, região musculosa com função de triturar o alimento.

08. Os poríferos e protozoários apresentam um sistema excretor formado por protonefrídios, constituído por uma célula-flama e um tubo ao qual ela se liga, permitindo a liberação de amônia ao meio.

16. Os nematelmintos excretam suas substâncias pelos túbulos de Malpighi, os quais absorvem excreções da hemolinfa lançando-as na cavidade intestinal para posterior eliminação.

Soma das alternativas corretas: (02 04)

04. (UCS) Uma senhora foi picada por um animal invertebrado e, preocupada, ligou para o Centro de Informações Toxicológicas (CIT), fone 0800 7213000, plantão 24 horas. O CIT solicitou a descrição do animal que, de acordo com as informações dadas, revelou-se ter quatro pares de patas, cefalotórax e abdômen fundidos e quelíceras. O animal descrito acima trata-se de um:

a) aracnídeo, uma centopeia.

b) aracnídeo, um carrapato.

c) inseto, um escorpião.

d) inseto, um percevejo.

e) diplópode, uma lacraia.

05. (UERJ) Um peixe ósseo com bexiga natatória, órgão responsável por seu deslocamento vertical, encontra-se a 20 m de profundidade no tanque de um oceanário. Para buscar alimento, esse peixe se desloca em direção à superfície; ao atingi-la, sua bexiga natatória encontra-se preenchida por 112 mL de oxigênio molecular. O deslocamento vertical do peixe, para cima, ocorre por conta da variação do seguinte fator:

a) densidade.

b) viscosidade.

c) resistividade.

d) osmolaridade.

06. (Unitau) Os Arthropoda representam um dos mais importantes grupos de seres vivos, com o maior número de espécies catalogadas, incluindo alguns dos animais mais populares, como mosquitos, baratas, aranhas, escorpiões, centopeias, caranguejos, entre muitos outros. Os Arthropoda, considerando toda a sua riqueza de espécies, podem ser encontrados em todos os diferentes ambientes do planeta, desempenhando as mais diferentes funções ecológicas. Avalie as informações contidas no quadro abaixo e assinale a alternativa que associa corretamente o grupo de artrópodos com as características morfológicas.

a) I-Arachnida; II-Crustacea; III-Insecta; IV-Chilopoda; V-Diplopoda.

b) I-Arachnida; II-Crustacea; III-Insecta; IV-Diplopoda; V- Chilopoda.

c) I-Arachnida; II-Insecta; III-Crustacea; IV-Chilopoda; V-Diplopoda.

d) I-Insecta; II-Arachnida; III-Crustacea; IV-Diplopoda; V-Chilopoda.

e) I-Chilopoda; II-Arachnida; III-Diplopoda; IV-Insecta; V-Crustacea.

07. (UEA) Leia a tirinha de Fernando Gonsales.

A planária tem grande facilidade de originar novos indivíduos após alguns seccionamentos corpóreos. Outro animal que consegue originar novos indivíduos pelo mesmo tipo de reprodução da planária é:

a) a mosca.

b) a lombriga.

c) o tubarão.

d) o caracol.

e) a esponja.

08. (UNITINS) Atualmente, existem cerca de 55 mil espécies de vertebrados, que têm como principal característica a existência da coluna vertebral em sua estrutura corpórea. Sobre esses animais, é correto afirmar que:

a) os amniotas são um grupo de tetrápodes representados atualmente pelos anfíbios.

b) espécies ovovivíparas são aquelas que incubam os ovos fora do corpo da mãe.

c) as aves têm uma relação de parentesco com um grupo de dinossauros chamado terópodes e, assim como esses répteis, são animais ectotérmicos.

d) os monotremados são representados pelos cangurus, gambás e colas.

e) os peixes-bruxa e as lampreias não apresentam mandíbulas, enquanto que os Gnatostômios (tubarões, anfíbios, répteis, aves e mamíferos) têm estruturas articuladas, as mandíbulas, que facilitam a predação desses animais.

09. (ETEC) Os vegetais precisam respirar. Para tanto, eles absorvem gás oxigênio do ambiente. Essa absorção ocorre principalmente através de suas folhas e de suas raízes. Assim, o solo precisa ter certa quantidade de ar para que as raízes possam absorver o gás oxigênio. Considerando esse aspecto, podemos afirmar que as minhocas prestam um importante serviço ecológico, pois contribuem para o arejamento do solo. As minhocas estão sempre cavando túneis e revolvendo a terra a procura de restos orgânicos, dos quais se alimentam, deixando a terra fofa e arejada. Além disso, esses túneis facilitam a drenagem das águas das chuvas. Em solos muito duros, normalmente não há minhocas, principalmente porque ali elas não conseguem cavar as suas galerias. Não existindo esses animais, a terra terá menos húmus e menos gás oxigênio e, portanto, oferecerá menos recursos para a vida vegetal. Sobre esses animais, e correto afirmar que:

a) são invertebrados, de vida parasitaria, como as lombrigas e as sanguessugas.

b) possuem corpo cilíndrico, não segmentado e respiram por meio de brânquias.

c) favorecem a agricultura, pois produzem o gás oxigênio necessário à respiração das raízes dos vegetais.

d) sintetizam a matéria orgânica de que necessitam para sobreviver a partir dos minerais que absorvem do solo.

e) rastejam e cavam túneis graças à contração e distensão coordenadas dos músculos de cada segmento do corpo.

10. (FACTO) No gráfico abaixo pode ser observada a variação da temperatura externa e a temperatura corporal de dois tipos de animais.

Após minuciosa análise do gráfico, marque entre as alternativas apresentadas, a única correta.

a) O animal 1 é pecilotérmico.

b) O animal 2 é homeotérmico.

c) O animal 2 pode ser um réptil.

d) O animal 1 não pode regular sua atividade metabólica.

e) O metabolismo do animal 2 é independente das variações da temperatura ambiente.

11. (UFAM) Existem diferentes tipos de respiração nos animais. Assinale a alternativa que correlaciona corretamente o tipo de respiração e o animal correspondente àquele tipo de respiração.

a) Respiração pulmonar – siri.

b) Respiração traqueal – tambaqui.

c) Respiração branquial – sapo.

d) Respiração cutânea – lagartixa.

e) Respiração cutânea – minhoca.

12. (UFRR)

A árvore filogenética parcial representa uma das hipóteses das relações evolutivas entre os grupos de animais representados acima. Os traços em negrito correspondem a uma característica que está presente nos grupos representados acima de cada um deles na árvore e que não está presente nos grupos abaixo deles. Os números 1, 2 e 3 indicados nos traços em negrito representam, respectivamente, quais características encontradas nesses grupos?

a) Presença de ovo amniótico, glândulas mamárias e penas.

b) Presença de tubo nervoso dorsal, ovo amniótico e casco.

c) Presença de homeotermia, pelos e penas.

d) Presença de vértebras, pelos e voo.

e) Presença de ovo amniótico, penas e pelos.

13. (UEPG) Os cnidários são animais diblásticos, isto é, apresentam apenas dois folhetos germinativos, ectoderma e endoderma. O ectoderma origina a epiderme, tecido que reveste o animal, enquanto o endoderma origina a gastroderme, tecido que reveste a cavidade digestiva. Unindo estes dois, há a mesogleia. Em relação aos tipos de células da epiderme e gastroderme dos cnidários, bem como suas respectivas funções, assinale o que for correto.

01. As células mioepiteliais epidérmicas são pequenas, localizam-se na mesogleia e não são totipotentes.

02. No interior das células intersticiais, encontra-se o nematocisto, o qual contém um líquido tóxico.

04. As células mioepiteliais digestivas da epiderme secretam muco, cujo papel é lubrificar o corpo, protegendo-o. No caso de cnidários sésseis, estas células permitem também a aderência do animal ao substrato.

08. As células sensoriais têm capacidade de perceber estímulos ambientais e transmiti-los a células nervosas presentes na mesogleia.

16. Os cnidoblastos, ou células urticantes, estão distribuídos por toda a epiderme do cnidário, concentrando-se nos tentáculos e ao redor da boca.

Soma das alternativas corretas:

14. (URCA) Os tubarões possuem um sexto sentido, a ampola de Lorenzini. Graças a ela, esses condrictes são capazes de:

a) ver no escuro.

b) captar infravermelho.

c) sentir seres de sangue quente nas proximidades.

d) manter-se sempre aquecido.

e) captar o campo elétrico produzido por seres que se encontram nas proximidades.

15. (UECE) Os seres vivos incluídos no Filo Porífera não apresentam tecidos ou órgãos definidos, mas possuem células que realizam diversas funções relacionadas à sua sobrevivência no ambiente aquático. Com relação aos coanócitos, células que compõem o corpo dos poríferos, é correto afirmar que:

a) são responsáveis pela distribuição de substâncias para todas as demais células do corpo do animal, por meio de plasmodesmos.

b) transformam-se em espermatozoides, sendo, portanto, essenciais para a reprodução sexuada nesses animais.

c) são células totipotentes que originam todos os outros tipos de células que compõem os tecidos desses animais.

d) são células flageladas que promovem o fluxo contínuo de água, promovendo a nutrição desses animais, pela a circulação da água no átrio da esponja.

16. (Unemat) Entre as classes de animais vertebrados encontramos variações fisiológicas e anatômicas. Essas variações são oriundas de processos evolutivos peculiares a cada espécie. Algumas características são compartilhadas entre as espécies de uma mesma classe de vertebrados. Considerando as características peculiares dos tubarões, pinguins e golfinhos, e as classes às quais esses animais pertencem, podemos afirmar que:

a) Esses três animais possuem hábitos que envolvem natação e as formas hidrodinâmicas do corpo dos tubarões, golfinhos e pinguins caracterizam um exemplo de irradiação adaptativa.

b) O coração dos tubarões possui 2 câmaras; dos golfinhos, 4 câmaras, e dos pinguins, 3 câmaras.

c) Tubarões e golfinhos são animais homeotérmicos, enquanto os pinguins são animais pecilotérmicos.

d) Ao observar a pele desses animais, percebe-se que os tubarões têm escamas, enquanto os

golfinhos têm pelos e os pinguins, penas.

e) Golfinhos e pinguins são animais ovíparos, enquanto tubarões são vivíparos ou ovíparos, dependendo de cada espécie.

17. (IFMT) O ambiente marinho é repleto de seres carnívoros e herbívoros, uns possuem esqueleto externo e outros interno. Há aqueles que são fixos e os que nadam ativamente e ainda, aqueles que apresentam sistema digestório completo, ou incompleto, podendo ser, até mesmo, ausente. Diante disso, assinale a alternativa que apresenta características da estrela-do-mar:

a) exclusivamente marinho e endoesqueleto calcário.

b) exoesqueleto quitinoso e predadores.

c) endoesqueleto calcário e alimentação por filtragem.

d) imobilidade e herbívoros.

e) sistema ambulacrário e exoesqueleto quitinoso.

18. (FEEVALE) Assinale a alternativa incorreta sobre a reprodução dos invertebrados.

a) Nos poríferos, ocorre reprodução assexuada por brotamento e sexuada com produção de larvas flageladas.

b) Nos cnidários, ocorre reprodução assexuada por brotamento e sexuada, na qual é comum a alternância de gerações.

c) Nos platelmintos, ocorre reprodução assexuada por fragmentação, existem espécies hermafroditas e com fecundação interna.

d) Nos nematelmintos, existem espécies de sexos separados, ocorre fecundação interna, e ovos originam larvas.

e) Minhocas são anelídeos hermafroditas, que geralmente apresentam autofecundação.

19. (UFMS) As aves são animais descritos em muitos versos da literatura brasileira, como os versos de Goncalves Dias em “Canção do Exilio”:

Minha terra tem Palmeiras

Onde canta o sabiá

As aves que aqui gorjeiam

Não gorjeiam como lá.

Esses versos expressam saudade usando o sabia, ave Passeriforme do clado Neognathae. Sobre as caracteristicas das aves, considere as afirmativas a seguir.

I. O ácido úrico é a principal substância nitrogenada excretada.

II. A respiração é pulmonar.

III. São animais dioicos e ovíparos.

Está(ão) correta(s):

a) Apenas I.

b) Apenas II.

c) Apenas III.

d) Apenas I e III.

e) I, II e III.

20. (UNESPAR) Das cerca de 1,2 milhões de espécies descritas atualmente, apenas menos de 4% são vertebradas, um subfilo de cordados. No entanto, ainda é comum separarmos para estudo, os animais em vertebrados e invertebrados. São características comuns a todos Chordata:

a) Notocorda, sistema nervoso dorsal e vértebras.

b) Notocorda, sistema nervoso dorsal e cauda pós-anal.

c) Vértebras, crânio e encéfalo.

d) Vértebras, pernas e membros.

 

Publicado por: Djalma Santos | 18 de maio de 2017

TESTES DE SISTEMA ENDÓCRINO (IV)

01. (PUC-SP) Um experimento foi conduzido para verificar a influência de um hormônio da tireoide sobre o metabolismo celular. Para isso, foram obtidas células hepáticas (hepatócitos) de ratos cujos níveis sanguíneos do hormônio foram previamente classificados como baixos, normais ou elevados. Sob condições controladas, foi medida a taxa de consumo de oxigênio de cada um dos três grupos de células, e o resultado está representado no gráfico a seguir.

Os resultados desse experimento permitem concluir que, nos hepatócitos dos ratos estudados,

a) o hipertireoidismo eleva o consumo de oxigênio na etapa citoplasmática da respiração celular.

b) o hipotireoidismo acelera a produção de ATP.

c) o hipertireoidismo estimula a fosforilação oxidativa.

d) o hipotireoidismo torna a cadeia respiratória um processo anaeróbio.

02. (IFNMG) Sobre o sistema endócrino humano, analise as afirmativas a seguir:

I. A paratireoide é a glândula produtora do hormônio calcitonina, responsável pela regulação das taxas de cálcio do sangue.

II. As gônadas (ovários e testículos) também são glândulas endócrinas, que produzem hormônios responsáveis pelo amadurecimento sexual e pelas características sexuais secundárias da espécie.

III. O glucagon e a insulina são hormônios produzidos a partir de células beta do pâncreas, que participam do controle dos níveis de glicose no sangue, com efeitos hiperglicemiante e hipoglicemiante, respectivamente.

IV. A hipófise, localizada na base do encéfalo, produz vários hormônios, como o gonadotrófico, o folículo estimulante e a prolactina, além de controlar o funcionamento da tireoide através da produção do hormônio TSH.

Estão corretas apenas as afirmativas:

a) apenas I e II.

b) apenas II e IV.

c) apenas II e III.

d) apenas III e IV.

03. (UFAM) Nos animais, as moléculas sinalizadoras se ligam a receptores na célula alvo, desencadeando respostas específicas nessa célula. Sobre a biossinalização, assinale a alternativa correta:

a) Reguladores locais são secretados pelas células sinalizadoras e atingem as células alvo em curtas distâncias. Um dos tipos de sinalização desencadeado por reguladores locais é o neuroendócrino.

b) Um hormônio é reconhecido pela sua especificidade de resposta, mesmo tendo como alvo, células diferentes.

c) Na sinalização endócrina, os hormônios secretados pelas células sinalizadoras atingem a célula alvo pelo sangue. Uma função associada a esse tipo de sinalização é a manutenção da homeostasia do organismo.

d) A insulina é produzida pelo pâncreas e em quantidade bem menos expressiva, pela hipófise anterior. A insulina atua reduzindo o nível de glicose no sangue.

e) Uma das funções do FSH (follicle stimulating hormone) é o estímulo da contração das células musculares uterinas e das glândulas mamárias.

04. (UFPA) O diabetes é um grupo de doenças metabólicas caracterizadas por hiperglicemia e associadas a complicações, disfunções e insuficiência de vários órgãos, especialmente olhos, rins, nervos, cérebro, coração e vasos sanguíneos.

(in: Diabetes Mellitus – Brasília: Ministério da Saúde, 2006. 64 p. – Cadernos de Atenção Básica, n. 16).

Sabe-se que em indivíduos normoglicêmicos (glicose ou açúcar no sangue em níveis normais) ocorrem variações na glicemia durante o dia, que aumenta logo após a ingestão de alimentos e diminui depois de algum tempo sem comer. A elevação constante da glicose no sangue pode ser sinal de diabetes. A respeito desse assunto, a afirmativa correta é:

a) Nos indivíduos não diabéticos, a glicemia aumenta logo após uma refeição e diminui entre as refeições por ação do tempo, pois a glicose é normalmente excretada do corpo através da urina.

b) Nos indivíduos não diabéticos, a glicemia aumenta logo após uma refeição e diminui entre as refeições, pois os açúcares ingeridos e digeridos são absorvidos pelo sangue no intestino delgado. Por efeito da insulina, a glicemia se reduz, porque parte da glicose do sangue é conduzida para as células do corpo.

c) Em indivíduos com diabetes melito, a glicemia elevada (hiperglicemia) é constante, pois há uma falência no sistema de transporte de açucares para os rins.

d) Em todos os casos de diabetes, ocorre destruição das células beta, responsáveis por produzir a insulina nas ilhotas do pâncreas.

e) A insulina é sempre utilizada para controle; não é necessária para a sobrevivência dos pacientes.

05. (UNESP) Um hormônio foi injetado na circulação sanguínea de uma pessoa. O gráfico mostra como a concentração de cálcio no sangue variou ao longo do tempo após a injeção.

É correto afirmar que o hormônio injetado na circulação sanguínea dessa pessoa foi:

a) o glucagon.

b) a tiroxina.

c) o paratormônio.

d) a calcitonina.

e) a aldosterona.

06. (UFU) João teve um tumor na tireoide e precisou remover, integralmente, essa glândula. Ele faz reposição hormonal via medicamentos. Caso não fizesse o tratamento, qual seria seu comprometimento?

a) Diminuição da concentração de glicose no sangue.

b) Diminuição da taxa metabólica basal.

c) Aumento dos ritmos cardíaco e respiratório.

d) Aumento da síntese de testosterona.

07. (PUCRS) O pâncreas é o órgão responsável pela produção de hormônios como a insulina e o glucagon. Sobre esses dois hormônios, é correto afirmar que:

a) a insulina é um hormônio hiperglicemiante, pois aumenta os níveis de glicose dentro das células.

b) o glucagon é um hormônio hipoglicemiante, pois diminui os níveis de glicose na circulação.

c) o glucagon promove o catabolismo das moléculas de glicogênio armazenadas no pâncreas em casos de jejum prolongado.

d) moléculas de lipídeos tendem a competir com a insulina pelo seu receptor em indivíduos com sobrepeso.

e) verifica-se produção de insulina em indivíduos com diabetes do tipo 1, mas não do tipo 2.

08. (UEM) A insulina, produzida e secretada pelo pâncreas, estimula a absorção de glicose pelas células musculares esqueléticas, pelos hepatócitos e pelas células do tecido adiposo. Considerando o exposto e assuntos correlatos, assinale o que for correto.

01. O glucagon tem efeito contrário à insulina, estimulando a liberação de glicose nas células musculares esqueléticas, nos hepatócitos e nas células do tecido adiposo.

02. A glicose absorvida após o estímulo gerado pela insulina será igualmente utilizada pelas células musculares esqueléticas, pelos hepatócitos e pelas células do tecido adiposo.

04. O pâncreas é uma glândula endócrina e exócrina.

08. As células citadas no comando da questão são estimuladas pela insulina por possuírem receptores de membrana para insulina, proteínas integrais de membrana sintetizadas pelo retículo endoplasmático rugoso.

16. A insulina é sintetizada pelo retículo endoplasmático rugoso, transportada em vesículas ao complexo golgiense e à membrana plasmática, sendo secretada por exocitose.

Soma das alternativas corretas

09. (UFLA) O hormônio que apresenta iodo em sua composição e regula o desenvolvimento dos vertebrados denomina-se:

a) Tiroxina.

b) Glucagon.

c) Oxitocina.

d) Vasopressina.

10. (UNAMA) “… Algumas mulheres muito produtivas, não só mental como fisicamente, têm uma antecipação da menopausa. Acredita-se que o mesmo fator interfira na produção de outros hormônios como o da glândula tireoide…”

(Fragmentos extraídos de “O LIBERAL”, de 05.03.2006).

Considerando o texto e seus conhecimentos sobre o assunto, analise as afirmativas abaixo:

I. Tanto a menopausa como o funcionamento da glândula tireoide estão na dependência da função da adenoipófise.

II. Apenas a menopausa depende dos hormônios liberados, ou não, pela adenoipófise.

III. A glândula tireoide exerce sua atividade independente de hormônios produzidos pela adenoipófise.

O correto está em:

a) Somente I.

b) Somente II.

c) Somente III.

d) I, II e III.

11. (UEPA) Leia o Texto abaixo para responder esta questão.

A bomba de infusão de insulina, que causa conforto ao usuário, é um equipamento pequeno e portátil que auxilia a terapia para liberação de insulina, hormônio que controla a glicose no sangue. Tal equipamento de tamanho aproximado de um telefone celular libera a insulina por meio de um pequeno tubo e uma cânula (conhecidos como o conjunto de infusão) colocados sob a pele. A quantidade de insulina liberada pode ser adaptada para satisfazer as necessidades humanas diárias do hormônio.

Modificado de: http://www.medtronicbrasil.com.br/yourhealth/diabetes/device/insulin-pump/what-is-it/. Acesso:16/09/2016.

Sobre o hormônio citado no Texto acima, analise as afirmativas a seguir.

I. Impede a entrada da glicose, que está no sangue, nas várias celulas do corpo, como a dos músculos e as do tecido adiposo.

II. E produzido na parte endócrina do pâncreas, pelas celulas do tipo beta.

III. Provoca o aumento do nível de glicose no sangue pela transformação do glicogênio do fígado.

IV. Tem ação hipoglicemiante porque diminui o nível de glicose no sangue.

V. Sua ausência ou deficiência aumenta o nível de glicose no sangue e causa a diabetes do Tipo 1 ou diabetes melito.

A alternativa que contém todas as afirmativas corretas é:

a) I, III e V.

b) II, III e IV.

c) II, IV e V.

d) III, IV e V.

e) I, II, III, IV e V.

12. (COVEST) O sistema nervoso e o sistema endócrino transmitem informações elétricas ou químicas para coordenar e regular as funções orgânicas, integrando o funcionamento do organismo. No que se refere a essa ação integradora dos sistemas nervoso e endócrino, analise as proposições seguintes.

I   II

0 0 – As ações do sistema nervoso central e do sistema endócrino são coordenadas por uma glândula de primeiro nível, conhecida como hipófise.

1 1 – Os hormônios possuem ação difusa em relação aos neurotransmissores, que atuam de forma mais localizada.

2 2 – O hipotálamo tem ação integradora dos dois sistemas, influenciando tanto as funções neurais quanto as funções endócrinas.

3 3 – A hipófise secreta hormônios reguladores que controlam outras glândulas. O cortisol é um exemplo disso.

4 4 – O hormônio ACTH faz parte da cadeia hormonal que atua em situações de estresse.

13. (UNIFOR) Leninha era uma menina baixinha, com músculos bem hipertrofiados e com muitas espinhas no rosto. Além destas características, todos na faculdade começaram a observar o aparecimento de muitos pelos no rosto. E assim, vários eram os comentários: “ela toma é bomba”… “parece a mulher barbada”… “deve usar anabolizante”… Provavelmente, os pelos no rosto de Leninha são devidos às altas concentrações de:

a) FSH sanguíneas estimuladas pelo estradiol presente no anabolizante.

b) LH presentes nos anabolizantes utilizados geralmente por atletas de fisiculturismo.

c) adrenalina nos anabolizantes que aceleram o metabolismo celular.

d) testosterona exógenas que estimulam o desenvolvimento de características secundárias.

e) insulina sanguíneas estimuladas pelo armazenamento de glicogênio.

14. (UFES) A hipófise produz e secreta uma série de hormônios que têm ação em órgãos distintos, sendo, portanto, considerada a mais importante glândula do sistema endócrino humano. Sobre os hormônios hipofisários, é correto afirmar que:

a) O FSH, produzido na hipófise anterior, facilita o crescimento dos folículos ovarianos e aumenta a motilidade das trompas uterinas durante a fecundação.

b) A vasopressina, secretada pelo lobo posterior da hipófise, é responsável pela reabsorção de água nos túbulos renais.

c) O hormônio adrenocorticotrópico (ACTH) é um esteroide secretado pela adeno-hipófise e exerce efeito inibitório sobre o córtex adrenal.

d) O comportamento maternal e a recomposição do endométrio, após o parto, ocorrem sob a influência do hormônio prolactina.

e) O hormônio luteinizante atua sobre o ovário e determina aumento nos níveis do hormônio folículo estimulante (FSH) após a ovulação.

15. (UDESC) Os seres humanos possuem diversas glândulas endócrinas, algumas delas podem inclusive produzir mais de um tipo de hormônio.

Associe o hormônio à glândula.

Coluna A

I. Prolactina.

II. Adrenalina.

III. Progesterona.

IV. Tiroxina.

V. Insulina.

Coluna B

(   ) Suprarrenal.

(   ) Pâncreas.

(   ) Tireoide.

(   ) Ovários.

(   ) Hipófise.

Assinale a alternativa que indica a associação correta, de cima para baixo.

a) III – IV – II – I – V.

b) II – V – IV – III – I.

c) I – III – IV – II – V.

d) V – II – I – III – IV.

e) II – IV – V – III – I.

16. (PUC-PR) O pâncreas é uma glândula mista que apresenta regiões de função endócrina denominadas de ilhotas de Langerhans; nessas ilhotas existem células alfa produtoras de glucagon, células beta produtoras de insulina, células delta que produzem somatostatina e células PP, que produzem um polipeptídeo pancreático. É conhecido que a insulina e o glucagon atuam regulando a glicemia (taxa de glicose no sangue). Os hormônios agem através de receptores específicos de alta afinidade. Um dos distúrbios típicos de glicemia é a diabetes mellitus, tipo I (diabetes mellitus insulinodependente) e tipo II (as células são resistentes à ação da insulina). O controle da glicemia ocorre da seguinte maneira:

Suponha que uma pessoa seja diabética tipo I e não esteja fazendo o controle da doença. Ela ingeriu carboidratos como amido, sacarose e lactose. Após a digestão e absorção dos carboidratos, espera-se que:

a) Ocorra o bloqueio das células alfa e a estimulação das células beta, provocando a glicogenólise e a hipoglicemia.

b) Seja liberado glucagon na corrente sanguínea, ocorrendo a glicogenólise e a hipoglicemia.

c) Aconteça a ligação entre insulina e os receptores específicos de membrana que facilitam a entrada de glicogênio nos hepatócitos do fígado.

d) Não ocorra a liberação de insulina (pelas células beta do pâncreas), promovendo hiperglicemia e gliconeogênese.

e) Aconteça uma redução da sensibilidade dos tecidos à insulina, promovendo a hipoglicemia.

17. (UNIVERSIDADA CATÓLICA SC) O uso excessivo e indiscriminado de remédios à base de corticoide é a causa principal (e evitável) de síndrome de Cushing. Afora esses casos, o diagnóstico de hipercortisolismo e a identificação de sua causa está, sem dúvida, entre as tarefas mais difíceis enfrentadas pelos endocrinologistas. (…)

Sinais e sintomas da síndrome de Cushing: Ocorre um aumento e redistribuição da gordura corporal, com obesidade abdominal (visceral), face em forma de “lua cheia”, giba costal (acúmulo de gordura na parte superior das costas) e membros relativamente magros (hipotrofia muscular). Os pacientes também desenvolvem pele com acne e estrias vinhosas, aumento de pelos fora das localizações habituais (hirsutismo), irregularidades menstruais, fraqueza, osteoporose, pressão alta, diabetes, predisposição a infecções e sintomas psicológicos como depressão ou psicose. Em crianças, pode provocar parada do crescimento.

Fonte: Acesso em: 18/12/2014.

O cortisol, hormônio cujo desequilíbrio é responsável pela doença de Cushing, é produzido pela mesma região e glândula que o(s) hormônio(s):

a) Adrenalina e noradrenalina.

b) Glucagon.

c) Ocitocina.

d) ADH.

e) Aldosterona.

18. (UEM) Os hormônios são compostos orgânicos produzidos por células isoladas ou por glândulas endócrinas e, quando liberados no sangue, são capazes de estimular ou inibir o funcionamento de um órgão. Sobre este assunto, assinale a(s) alternativa(s) correta(s).

01. As paratireoides localizam-se na base do encéfalo, armazenam e liberam hormônios produzidos no hipotálamo e produzem os hormônios gonadotrópicos.

02. O hormônio antidiurético (ou vasopressina), produzido nas glândulas suprarrenais, atua sobre os rins promovendo a formação de grande quantidade de urina.

04. A tireoide, localizada na região anterior do pescoço, produz hormônios com iodo em sua composição, que atuam sobre a taxa metabólica basal.

08. A oxitocina é produzida na neurohipófise, sendo responsável pela contração da musculatura uterina, e estimula a liberação do leite durante a amamentação.

16. A deficiência na produção de tiroxina causa hipotireoidismo, o que leva a pessoa a ser pouco ativa, a ganhar peso, e a apresentar pele fria.

Soma das alternativas corretas:

19. (PUC-Campinas) Apesar do automatismo da contração cardíaca, o pulsar do coração também é regulado por mediadores químicos capazes de alterar o ritmo dos batimentos. O mediador químico que acelera e o que diminui o ritmo cardíaco são, respectivamente, a:

a) Acetilcolina e a adrenalina.

b) Acetilcolina e a ocitocina.

c) Ocitocina e a acetilcolina

d) Adrenalina e a acetilcolina.

e) Adrenalina e a ocitocina.

20. (UNIMONTES) Geralmente, alterações no sistema endócrino criam um amplo quadro de sinais e sintomas que, em conjunto com exames laboratoriais e de imagem, auxiliam no diagnóstico de uma determinada doença. O quadro abaixo apresenta alguns sinais e sintomas característicos de uma doença. Analise-o.

Tomados no seu conjunto, é correto afirmar que a doença em questão é:

a) Dengue.

b) Hipertensão arterial.

c) Hipertireoidismo.

d) Hepatite.

Publicado por: Djalma Santos | 18 de maio de 2017

TESTES DE GENÉTICA MOLECULAR (10)

01. (UNICENTRO) A relação A + G / C + T = 0,2 em uma das fitas do DNA. Sabendo-se que, nessa molécula, há duas fitas, o valor dessa mesma relação, A + G / C + T, na fita complementar, é de:

a) 0,2.

b) 0,8.

c) 1,0.

d) 5,0.

02. (UEPG) James Watson e Francis Crick resolveram a estrutura do DNA em 1953, rendendo-lhes inclusive um prêmio Nobel. Em relação às características desta molécula, assinale o que for correto.

01. Uma mutação em uma única base nitrogenada não é capaz de prejudicar a estrutura de uma proteína e levar a manifestação de uma doença. Já as mutações cromossômicas, por exemplo, trissomia do 21, são extremamente graves.

02. A replicação do DNA é dita semiconservativa, sendo que cada uma das fitas é utilizada como molde para a síntese de uma fita complementar, polimerizada pela enzima DNA polimerase.

04. O DNA é uma molécula constituída por nucleotídeos organizados em fita única, os quais se unem por ligações denominadas pontes de hidrogênio.

08. O DNA é constituído por vários nucleotídeos em sequência, os quais são formados por um grupo fosfato, uma base nitrogenada e uma pentose, a desoxirribose.

16. Uma sequência de DNA, denominada gene, pode ser transcrita em moléculas de RNA pela enzima RNA polimerase, processo denominado de transcrição.

Soma das alternativas corretas:

03. (Unisinos) Os ácidos nucleicos (o DNA, ácido desoxirri­bonucleico, e o RNA, ácido ribonucleico) são macromoléculas formadas por unidades mo­noméricas menores (nucleotídeos). Ocorrem em todas as células vivas e realizam o arma­zenamento, a transmissão e a tradução da in­formação genética. Com base nisso, avalie as proposições abaixo, comparando a estrutura desses ácidos.

I. O RNA é formado por duas cadeias polinucleotídi­cas e está envolvido no processo de transcrição e síntese de proteínas.

II. A quantidade de RNA varia de célula para célula, e sua presença pode ocorrer por curtos períodos de tempo.

III. O DNA armazena a informação genética da maioria dos “seres vivos” e é quimicamente pouco estável.

Sobre as proposições acima, é correto afirmar que:

a) apenas I está correta.

b) apenas II está correta.

c) apenas III está correta.

d) apenas I e II estão corretas.

e) I, II e III estão corretas.

04. (UDESC) Analise as proposições, em relação aos Ácidos Nucleicos, e assinale (V) para verdadeira e (F) para falsa.

( ) Os ácidos nucleicos são moléculas gigantes formadas por unidades chamadas de nucleotídeos.

( ) O RNA transportador é formado a partir de regiões específicas do DNA.

( ) O RNA ribossômico associado com proteínas forma os ribossomos.

( ) O DNA apresenta-se altamente condensado nas células procarióticas.

Assinale a alternativa que apresenta a sequência correta, de cima para baixo.

a) F – V – V – F.

b) F – F – V – V.

c) V – V – V – F.

d) V – F – V – V.

e) V – F – F – V.

05. (UCS) A Reação em Cadeia da Polimerase (Polymerase Chain Reaction – PCR) é uma técnica muito utilizada em pesquisas científicas, que consiste na amplificação (ou a criação de várias cópias) de um segmento do DNA. É uma técnica utilizada para o sequenciamento de genes, diagnóstico de doenças, testes de paternidade e até para a criação de organismos geneticamente modificados. Essa técnica só é possível devido às características naturais de replicação da fita de DNA. Em relação à replicação do DNA, pode-se afirmar que:

a) é um processo chamado de semiconservativo, pois uma das fitas é nova (recém-sintetizada), e a outra provém da dupla fita de DNA já existente, ambas formando uma dupla fita.

b) a separação das fitas, no momento da duplicação, se dá pelo efeito de uma enzima chamada DNA Polimerase.

c) o RNA formado a partir do processo de replicação do DNA é chamado de RNA mensageiro.

d) os ribossomos se ligam à fita de DNA durante o processo de replicação e, a partir dessa ligação, são sintetizadas novas proteínas.

e) os pares da fita original de DNA se separam, e os nucleotídeos livres vão se emparelhando com a fita nova, sempre seguindo a regra A-U C-G.

06. (PUC-PR) Leia o texto a seguir:

Genes bailarinos

Equipe do Incor reduz de 2 mil para 80 os fragmentos de DNA candidatos a explicar a origem da hipertensão

Recebemos como carga genética os mecanismos controladores da pressão, eles fazem a síntese dos mecanismos pressores e depressores. Essa carga pode facilitar a produção de substâncias pressoras ou formar menos substâncias hipotensoras. Essa predisposição, entretanto, não basta. Para o problema eclodir, há que se ter o concurso decisivo do meio ambiente, que está o tempo todo suscitando regulação da pressão arterial. E esse meio ambiente é o sal, a inatividade, a obesidade, o estresse, todas essas coisas que, de uma forma ou de outra, mexem com o sistema de regulação. Alguém com um sistema de regulação muito bom pode ser submetido a todas as pressões ambientais e seguir com a pressão normal. Mas outro, com um sistema muito ruim, pode ficar sem comer um grama de sal, deitado numa rede, e vai ficar hipertenso. É esse “o estado da arte atual” sobre a hipertensão essencial ou primária. Sabe-se dessa “combinação do terreno com o meio ambiente” e não se sabe “mexer no terreno” preventivamente, mas é o que se quer conseguir. Se os genes envolvidos na hipertensão forem identificados, se for possível saber a carga genética de cada um e, com base nisso, trabalhar com aconselhamento genético, talvez a hipertensão essencial que atinge 50% dos adultos acima de 60 anos se torne uma epidemia do passado.

Disponível em: <http://revistapesquisa.fapesp.br/2012/08/22/genes-bailarinos/?cat=medicina&gt;. Adaptado.

A identificação dos fragmentos de DNA possibilitará uma proposta de intervenção, uma vez que,

a) o conhecimento da carga genética, que associada aos fatores do meio é o que define o fenótipo do indivíduo, possibilita a compreensão da manifestação da hipertensão.

b) sabendo-se quais são os genes envolvidos, é possível uma terapia genética que induza a não manifestação desse material, a qual estaria disponível para a maior parte da população.

c) conhecendo-se o genótipo dos hipertensos, descobre-se a única fonte desencadeadora do aumento de pressão arterial.

d) os fatores ambientais são preponderantes sobre os fatores genéticos, os quais só se manifestam quando induzidos pelo meio.

e) a hipertensão não tem relação com hábitos de vida, mas está associada unicamente à predisposição genética.

07. (ACAFE)

Mutação genética explica preferência por alimentos gordurosos

A predileção por comidas gordurosas em algumas pessoas com sobrepeso ou obesas pode ter uma explicação genética. Um estudo conduzido na Universidade de Cambridge, no Reino Unido, e divulgado na última edição da revista Nature Communications, mostra que uma mutação no gene MC4R faz com que indivíduos tenham um paladar reduzido para o açúcar levando-os, como mecanismo de compensação, a ingerir doses exageradas de gordura. A estimativa é de que essa falha genética acometa uma em cada 100 pessoas com problemas de peso.

Fonte: Correio Braziliense, 10/10/2016.Disponível em: http://www.correiobraziliense.com.br

Assim, analise as afirmações a seguir.

I. As mutações são denominadas sem sentido quando alteram o código genético, mas não alteram o produto gênico.

II. As mutações podem ser causadas por erros durante o processo de replicação do DNA, por agentes físicos, por agentes químicos, e por agentes biológicos, como alguns vírus, por exemplo.

lll. Deleções são mutações nas quais um trecho de DNA é perdido. As deleções tendem a ser, especialmente, mais prejudiciais quando o número de pares de bases perdidas não for um múltiplo de três.

lV. As aneuploidias são mutações em que há perda ou acréscimo de 1 ou mais cromossomos da célula. Surgem devido a erros na distribuição dos cromossomos durante as divisões celulares, tanto na mitose quanto na meiose.

Todas as afirmações estão corretas em:

a) I – II – III.

b) II – III – IV.

c) II – IV.

d) III – IV.

08. (UFU) A Klebsiella pneumoniae carbapenemase (KPC), também conhecida como superbactéria, quando entra no organismo, é capaz de produzir infecções graves. O surto da bactéria está frequentemente relacionado ao uso indiscriminado de antibióticos. A seguir está representado como surgem cepas resistentes.

08

Considerando os argumentos neodarwinistas para explicar a multirresistência da KPC aos antibióticos, é incorreto afirmar que:

a) Bactérias resistentes podem transferir a outras bactérias anéis de DNA que garantem a variabilidade entre bactérias, conferindo resistência aos antibióticos.

b) A utilização de antibióticos de forma indiscriminada propicia a seleção de bactérias resistentes.

c) O uso de antibióticos provoca alterações no DNA da bactéria, tornando-a cada vez mais resistente.

d) O mecanismo de mutação no código genético das bactérias pode conferir resistência a antibióticos.

09. (UNESP) Nas células ocorrem reações químicas para a síntese de moléculas orgânicas necessárias à própria célula e ao organismo. A figura mostra a reação química de formação de uma estrutura molecular maior a partir da união de três outras moléculas menores.

09

Esta reação química ocorre no interior da célula durante a:

a) formação dos nucleotídeos.

b) tradução do RNA mensageiro.

c) formação dos triglicerídeos.

d) transcrição do DNA.

e) síntese dos polissacarídeos.

10. (UNICAMP) A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses.

CACTTGTAAAACCAGTATAGACCCTAG (1)

CACTTGTAAAACCAGGATAGACGCTAG (2)

CACTTGTAAAACCAGTATAGACGCTAG (3)

CATTTTTAACACCAGGATAGACGCTAT (4)

Assinale a alternativa correta.

a) As espécies 1 e 4 são mais próximas entre si do que as espécies 1 e 3.

b) As espécies 2 e 3 são mais próximas entre si do que as espécies 1 e 3.

c) As espécies 1 e 3 são mais próximas entre si do que as espécies 3 e 4.

d) As espécies 2 e 4 são mais próximas entre si do que as espécies 1 e 2.

11. (Unitau) “[…] o refugiado austríaco Erwin Chargaff, do College of Physicians and Surgeons da Universidade Columbia, empregou uma nova técnica – cromatografia em papel – para medir as quantidades relativas das quatro bases em amostras de DNA extraídas de uma variedade de vertebrados e bactérias. Embora algumas espécies tivessem um DNA em que predominavam a adenina e a timina, outras tinham DNA com mais guanina e citosina. Despontou assim a possibilidade de não haver duas moléculas de DNA com a mesma composição.”

WATSON, J. D. DNA: O Segredo da Vida. São Paulo: Companhia das Letras, 2005, p. 470.

A descrição de Watson indica o momento inicial para a elaboração da Regra de Chargaff. Com base nessa regra, se analisarmos um fragmento de DNA com 320pb, das quais 30% são compostas por nucleotídeos contendo timinas, qual a quantidade de bases citosina e de guanina nesse mesmo fragmento?

a) Citosina = 70; guanina = 70.

b) Citosina = 64; guanina = 64.

c) Citosina = 128; guanina = 128.

d) Citosina = 70; guanina = 30.

e) Citosina = 128; guanina = 64.

12. (UEM) Sobre o material genético, assinale o que for correto.

01. A duplicação do material genético de eucariotos ocorre durante a anáfase da mitose.

02. Entende-se por gene o segmento de DNA capaz de codificar um RNA.

04. Em um gene ativo, a RNA polimerase está complementando os desoxirribonucleotídeos da região codificante com ribonucleotídeos complementares e realizando ligações fosfodiester entre eles.

08. Toda mutação em genes que codificam proteínas em eucariotos altera a sequência de aminoácidos na proteína codificada neste gene.

16. Eucariotos se distinguem de procariotos, neste quesito, por possuírem histonas associadas ao DNA, formando cromatina.

Soma das alternativas corretas:

13. (Anhembi Morumbi) Uma determinada sequência de nucleotídeos de um segmento de RNA mensageiro, ao ser traduzida pelos ribossomos, codifica uma sequência específica de aminoácidos. Essa correspondência fundamenta o sistema genético de codificação que:

a) regula a síntese de aminoácidos a partir dos nucleotídeos do RNA transportador.

b) varia entre as diferentes espécies, em função da alta diversidade existente.

c) constitui a relação em que cada nucleotídeo de adenina se liga a um nucleotídeo de timina.

d) é baseado em apenas 20 possibilidades de trincas de nucleotídeos, denominadas códons.

e) determina a exata posição dos aminoácidos na proteína sintetizada.

14. (PUC-RIO) A interação do DNA com as proteínas histonas é responsável pelo enovelamento e compactação do DNA nos núcleos das células eucarióticas, funcionando também como uma forma de regular a expressão gênica. Dois tipos celulares (por exemplo, linfócitos e neurônios) oriundos de um mesmo organismo não são iguais porque diferem:

a) nos ribossomos.

b) nos cromossomos.

c) nas proteínas histonas.

d) nas sequências das moléculas de DNA.

e) nas moléculas de RNA mensageiro produzidas.

15. (FATEC) Leia o texto para responder esta questão.

Hormônio do crescimento de plantas é alvo de pesquisa chinesa

Um grupo de pesquisadores tem como principal objetivo desvendar o funcionamento dos hormônios nas plantas.

“Um desses fitormônios é o etileno, molécula de gás que regula uma ampla gama de processos, incluindo o amadurecimento de frutos, o envelhecimento de folhas e de flores, a tolerância ao estresse e a defesa contra patógenos”, explicou o pesquisador Hongwei Guo, professor da Escola de Ciências da Vida da Universidade de Pequim.

“Temos estudado fatores que medeiam a regulação de respostas de plantas ao etileno, como a interação com outros fitormônios. Essas interações indicam a existência de complexas redes de sinalização na ação do etileno nas plantas”. Entre esses outros hormônios, o pesquisador mencionou a citocinina, a auxina e a giberelina.

“Identificamos que os fatores de transcrição conhecidos como EIN3 e EIL1 representam uma integração fundamental nas achoes entre o etileno e outros fitormônios”, disse Guo.

<http://tinyurl.com/jrz82hw&gt; Acesso em: 24.08.2016. Adaptado.

Fatores de transcrição como o EIN3 e EIL1 são proteínas essenciais no controle da expressão genetica. Quando elas se ligam ao DNA de células eucarióticas, permitem que haja uma ligação entre a enzima RNA-polimerase e o DNA, possibilitando, assim, a transcrição e a futura tradução.

Caso a equipe de pesquisadores consiga suprimir fatores de transcrição como o EIN3 e o EIL1 em algumas celulas, elas deverão apresentar, quando comparadas as demais células,

a) maior concentração de DNA.

b) maior concentração de clorofilas.

c) maior concentração de cloroplastos.

d) menor concentração de celulose.

e) menor concentração de RNA.

16. (UFPA) Griffith, em 1928, em experimentos realizados com linhagens da bactéria Streptococus pneumoniae, conforme ilustra a figura abaixo, demonstrou que:

I. uma linhagem (S) é letal quando inoculada em camundongos (a), enquanto que outra linhagem (R) é um tipo mutante não letal (b).

II. bactérias (S) são encapsuladas com polissacarídeos, que não estão presentes nas bactérias (R).

III.  bactérias (S), quando mortas pelo calor não provocavam morte nos camundongos (c). No entanto, uma mistura de bactérias (S) mortas pelo calor e bactérias (R) vivas provocava a morte dos camundongos (d).

Além disso, as células vivas recuperadas dos camundongos mortos geravam colônias (S) que eram letais em injeção subsequente.

16

Com base nos conhecimentos atuais sobre biologia molecular, a alternativa correta para a descrição do processo de transformação representado acima é:

a) O envoltório celular pode ser o agente transformante, visto que bactérias R mortas pelo calor e bactérias S apresentam constituição semelhante de seus envoltórios celulares.

b) Um experimento no qual se destrói o DNA das bactérias resultaria em bactérias R incapazes de transformar bactérias S em virulentas, o que demonstra que o DNA é o agente responsável pela modificação da expressão gênica nas bactérias S.

c) A diferença entre as linhagens S e R é a presença, nestas últimas, de uma capa de polissacarídeos (açúcares) em seu revestimento. Logo, a destruição de polissacarídeos deve resultar em perda da capacidade transformante das bactérias R mortas pelo calor.

d) A desnaturação proteica das bactérias R mortas pelo calor comprova que o agente transformante são as proteínas.

e) Nenhum procedimento isolado de destruição química das principais categorias de macromoléculas resultaria em perda do poder transformante das bactérias S, uma vez que a transformação resulta da ação combinada de todas as macromoléculas presentes na célula.

17. (UFAM) As moléculas de DNA e RNA são fantásticos repositórios informacionais comuns a todos os seres vivos. Analise as afirmativas e assinale a alternativa correta:

a) Houve um período abiótico em que as moléculas de DNA dominaram o planeta.

b) Além de serem moléculas informacionais, o DNA e o RNA também apresentam atividade enzimática.

c) Na dupla hélice do DNA, as bases púricas (citosina e timina) ligam-se às bases pirimídicas (adenina e guanina).

d) Um nucleotídeo nos ácidos nucleicos é formado por um fosfato ligado a um açúcar que, por sua vez, é ligado a uma base nitrogenada.

e) As moléculas de RNA são compactadas nos nucleossomas.

18. (UERR) Analise as afirmativas sobre os ácidos nucléicos DNA e RNA.

I. O DNA e o RNA são formados pelo encadeamento de grande número de moléculas menores, os nucleotídeos.

II. No RNA, está presente a pentose ribose e, no DNA, a pentose desoxirribose.

III. As duas cadeias de um RNA mantêm-se unidas por meio de ligações de hidrogênio

IV. Adenina, citosina, timina e guanina ocorrem tanto no DNA quanto no RNA.

V. A transcrição é o processo pelo qual a molécula de RNA é formada a partir da molécula de DNA.

Estão corretas apenas as afirmativas:

a) I, II e V.

b) II, III e IV.

c) I, II e III.

d) III, IV e V.

e) I, III e V.

19. (UEA) Dois irmãos gêmeos univitelinos de pele clara moravam em Gramado (RS). Um dos irmãos se mudou para Fortaleza (CE), onde começou a praticar surfe, exposto frequentemente ao Sol. O irmão que permaneceu em Gramado dificilmente ficava exposto ao Sol e somente praticava esportes em ambientes fechados. Passado um ano, os irmãos se reencontraram e a diferença entre o tom de pele de ambos ficou evidente. Com relação à síntese de melanina, essa diferença deve-se ao fato de os irmãos apresentarem:

a) genótipos iguais que levam à síntese de diferentes quantidades de melanina, dependendo da interação desses genótipos com o ambiente.

b) genótipos diferentes que levam à síntese de diferentes quantidades de melanina, dependendo da interação desses genótipos com o ambiente.

c) genótipos diferentes que levam à síntese da mesma quantidade de melanina, independentemente das condições do ambiente.

d) genótipos iguais que levam à síntese da mesma quantidade de melanina, independentemente das condições do ambiente.

e) genótipos iguais que sofrem mutações que levam à síntese da mesma quantidade de melanina, para adaptar a pele ao tipo de ambiente.

20. (URCA) O DNA é chamado molécula da vida. O princípio da ação dessa molécula é levar as características de uma geração para outra. A respeito do DNA é correto:

a) as pontes de hidrogênio são responsáveis pelo código genético.

b) as bases nitrogenadas são os açúcares presentes nos ácidos nucléicos.

c) as variações ocorrentes nas espécies são variações do ácido fosfórico.

d) a diferença entre DNA e RNA está apenas no tamanho entre essas moléculas.

e) a base do código genético são as variações dos tipos de bases nitrogenadas.

gab

 

Publicado por: Djalma Santos | 11 de maio de 2017

TESTES DE TAXONOMIA (3)

01. (ACEFE) O reino animal possui uma grande variedade de organismos, compreendendo cerca de um milhão de espécies catalogadas, embora acredita-se que este número possa ser superior a três milhões de espécies viventes. A seguir está representada uma das hipóteses para explicar a filogenia animal.

Considere as informações contidas na árvore filogenética e os conhecimentos relacionados ao tema. Assim, e correto afirmar, exceto:

a) Uma árvore filogenética é uma representação gráfica que organiza os seres vivos de acordo com o seu grau de parentesco evolutivo. Pela análise da árvore filogenética pode-se concluir que a estrela do mar possui um ancestral comum com os animais do Filo Chordata.

b) No Filo Chordata encontramos animais caracterizados pela presença de uma simetria bilateral, notocorda, um tubo nervoso dorsal, fendas branquiais e uma cauda pós-anal, em pelo menos uma fase de sua vida.

c) Pode-se afirmar que pseudoceloma, metameria e presença de apêndices articulados estão presentes respectivamente nos Filos Nematoda, Annelida e Arthropoda.

d) O Filo Porifera apresenta organismos extremamente simples, sendo desprovidos de tecidos e órgão, apresentando somente células nervosas difusas.

02. (PUC-PR) Leia o texto abaixo publicado na revista Veja:

Uma homenagem à série de livros Harry Potter, escrita pela britânica J. K. Rowling, foi feita no mundo animal. Visitantes do Museu de História Natural de Berlim, na Alemanha, escolheram em votação o nome Ampulex dementor para uma espécie de vespa recém-descoberta. A escolha do nome foi divulgada em um artigo publicado no periódico Plos One. O nome faz referência aos “dementadores”, guardas de uma prisão de alta segurança, temidos por serem capazes de sugar a alma de suas vítimas com um “beijo”. O motivo da comparação é o modo como as vespas atacam suas presas: elas injetam na cabeça de outros insetos substâncias que as transformam em “zumbis”, para então levá-las ao seu ninho, onde serão devoradas. Na descrição de J. K. Rowling, uma pessoa que tem a alma sugada pelos dementadores se torna uma “concha vazia”, em “estado vegetativo permanente”.

Disponível em: < http://veja.abril.com.br/noticia/ciencia/vespa-ebatizada-em-homenagem-a-serie-harry-potter&gt;. Acesso em:28/08/2014

Considerando o termo Ampulex dementor e os seus conhecimentos sobre regras básicas de classificação e nomenclatura, responda:

I. Ampulex é o nome do gênero desse organismo e dementor seria o nome da espécie.

II. A nomenclatura utilizada pela revista está grafada de forma incorreta, pois o binômio deveria estar destacado.

III. A vespa-joia (Ampulex compressa) é do mesmo gênero do animal recém-descoberto, mas não é necessariamente da mesma família.

IV. Um dos motivos utilizados para classificá-la nesse grupo pode ter sido a presença de cefalotórax e abdômen.

a) Somente a afirmativa III está correta.

b) Somente as afirmativas I e III estão corretas.

c) Somente as afirmativas I, II e IV estão corretas.

d) Somente a afirmativa II está correta.

e) As afirmativas I, II, III e IV estão corretas.

03. (UNIMONTE) O quadro a seguir apresenta uma classificação taxonômica do café. Analise-o.

Considerando o quadro apresentado e o assunto abordado, assinale a alternativa que representa a categoria taxonômica que caracteriza o café como uma angiosperma.

a) Coffea arábica.

b) Magnoliophyta.

c) Asteridae.

d) Rubiaceae.

04. (UFPA) Não seria uma surpresa se lêssemos um rótulo de uma lata de fermento e percebêssemos que o ingrediente mais importante presente no seu conteúdo fosse um grupo de seres vivos empregados na fabricação do pão. Sem a sua utilização, seria impossível obtermos o pão como o conhecemos hoje, de massa leve e macia. O fermento, ou “fermento biológico” como é mais conhecido, nada mais é do que uma grande quantidade de células de Saccharomyces cerevisae, um microrganismo muito utilizado na fabricação de bebidas alcoólicas, pães, bolos, biscoitos, etc.

Informações disponíveis em: http://www.ufrgs.br/alimentus/pao/ingredientes/ing_fermento01_e.htm.Acesso em: 22 abr. 2012.

Esses microrganismos fazem parte de um grupo de seres vivos denominados:

a) Protozoários.

b) Moluscos.

c) Bactérias.

d) Moneras.

e) Fungos.

05. (UEA) A figura ilustra a divisão dos seres vivos em grandes grupos.

Trata-se de uma divisão na qual um dos critérios adotados para o estabelecimento dos seres vivos em grupos é:

a) A complexidade de seus tecidos celulares.

b) O número de células presentes em seus integrantes.

c) O tipo de reprodução celular que realizam.

d) O metabolismo energético de suas células.

e) A organização de suas células ou tecidos.

06. (UEMA) Cladogramas são diagramas que indicam as relações filogenéticas ou genealógicas entre espécies ou grupos de seres vivos, dentre eles os grupos dos peixes. Analise o cladograma abaixo para responder à questão.

Os números I, II, III e IV do cladograma apresentado correspondem, respectivamente, aos seguintes grupos:

a) Agnatos, Gnatostomados, Ostheicthyes e Chondrichthyes.

b) Agnatos, Gnatostomados, Chondrichthyes e Ostheicthyes.

c) Gnatostomados, Agnatos, Ostheicthyes e Chondrichth

d) Gnatostomados, Agnatos, Chondrichthyes e Ostheict

e) Ostheicthyes, Agnatos, Chondrichthyes e Gnatostomados.

07. (UECE) Árvores filogenéticas são diagramas representativos da classificação biológica, organizados com base em dados anatômicos, embriológicos e de informações derivadas do estudo de fósseis. Considerando as características dos organismos pertencentes aos cinco Reinos, é correto afirmar que:

a) O Reino Animalia engloba seres vivos vertebrados, invertebrados, unicelulares, pluricelulares e preferencialmente heterótrofos.

b) Seres pluricelulares, clorofilados e eucariontes pertencem ao Reino Plantae.

c) Organismos autótrofos responsáveis pela decomposição da matéria orgânica animal ou vegetal pertencem ao Reino Fungi.

d) Os Reinos Protista e Monera englobam, respectivamente, protozoários e algas.

08. (MACK)

O esquema acima mostra, de maneira simplificada, a árvore filogenética dos grandes grupos de seres vivos. A respeito dessa árvore, são feitas as seguintes afirmações:

I. As arqueobactérias são mais antigas do que as eubactérias.

II. As arqueobactérias são parentes mais próximas dos animais e vegetais do que as eubactérias.

III. As arqueobactérias e eubactérias apareceram na mesma época geológica.

IV. Arqueobactérias, eubactérias e eucariontes tiveram o mesmo ancestral comum.

Estão corretas, apenas:

a) I e II.

b) I e III.

c) I e IV.

d) II e III.

e) II e IV.

09. (UPE) Blu e Jade, um casal de araras azuis, levou seus filhotes a uma expedição. Blu gosta muito de estudar e está tentando ensinar os filhotes a identificarem os seres vivos.

(Disponível em: http://www.100hdwallpapers.com/2014_rio_2_movie-widescreen_wallpapers_pt.html)

Ajude-os a fazer a identificação correta.

a) As plantas e os animais pertencem a Filos diferentes por serem autótrofos.

b) A rã e a aranha fazem parte do Subfilo Vertebrata.

c) O jacaré, a cobra, a rã e as araras pertencem à Classe Carnívora.

d) O jacaré e a cobra são répteis de Ordens diferentes.

e) Os répteis e as aves pertencem à mesma Família.

10. (PUC-RIO) Fabaceae, também conhecida como Leguminosae, é uma das maiores famílias botânicas. A família apresenta diferentes hábitos. Dentre as espécies, verifica-se:

Com base nas regras de nomenclatura, o quadro acima apresenta:

a) Nove gêneros e nove espécies.

b) Cinco gêneros e nove espécies.

c) Nove gêneros e cinco espécies.

d) Cinco gêneros e cinco espécies.

e) Nove gêneros e uma família.

11. (PUC-PR) Um grupo de organismos é descrito da seguinte forma:

I. Têm digestão extracorporal e absorvem os nutrientes após suas enzimas digestivas agirem sobre o meio.

II. Têm importante ação como decompositores e parede celular feita predominantemente de quitina.

III. Alguns são parasitas de outros seres vivos e todos são eucariontes.

IV. Muitos têm relações simbióticas ou de mutualismo com outros seres.

O grupo de organismos que preenche a todas estas características é o dos:

a) Moneras.

b) Protozoários.

c) Fungos.

d) Musgos.

e) Vegetais.

12. (UNIMONTES) Para estudar os seres vivos existentes na Terra, desde a antiguidade, procura-se reuni-los em grupos. O lugar onde eles vivem, a sua utilidade para o homem já foram critérios de agrupamento. Hoje, os seres vivos podem ser classificados com base em caracteristicas tanto externas quanto internas. Mesmo técnicas de biologia molecular vem sendo utilizadas para identificar esse grau de parentesco. O esquema abaixo está relacionado com esse assunto. Analise-o:

Considerando o esquema e o assunto abordado, analise as alternativas abaixo e assinale a que representa a associação correta entre a categoria taxonômica e o exemplo apresentado.

a) VI – Passiflora.

b) I – Magnoliopsida.

c) III – Passifloraceae.

d) V – Plantae.

13. (UNESP) Leia os versos da música Águas de Março, de Tom Jobim, para responder esta questão.

                                            É pau, é pedra, é o fim do caminho

                                            É um resto de toco, é um pouco sozinho

                                            É um passo, é uma ponte, é um sapo, é uma rã

                                            É um belo horizonte, é uma febre terçã

                                           São as águas de março fechando o verão

                                           É a promessa de vida no teu coração

(www.radio.uol.com.br)

O sapo, a rã e a febre terçã não fazem parte dos versos apenas por uma necessidade de rima, também têm relação com as chuvas que caem em regiões de clima tropical.  Sobre o sapo e a rã, referidos na letra de Tom Jobim, é correto afirmar que:

a) Fazem parte de um mesmo táxon, Amphibia, ao mesmo tempo em que diferem em categorias taxonômicas abaixo deste.

b) A reprodução no período de chuvas lhes confere vantagem adaptativa sobre os répteis, o que lhes permite explorar uma maior diversidade de hábitats.

c) Têm em comum com alguns insetos o fato de passarem por metamorfose durante o desenvolvimento, o que os torna evolutivamente próximos aos insetos e distantes dos demais vertebrados.

d) Compartilham entre si um ancestral comum mais antigo que aquele que compartilham com os répteis ou mamíferos.

e) São o macho e a fêmea de uma mesma espécie, podendo cruzar entre si e deixar descendentes férteis.

14. (UFSJ) A espécie hipotética Grifinoria sonserina foi descrita por Dumbledore em 1929. Posteriormente, em 2002, fazendo uma revisão da família Corvinalidae, Potter inseriu a espécie descrita por Dumbledore no mesmo gênero da espécie Lufa lufa. Com as informações supracitadas, a maneira correta de se descrever a espécie, seguida de seu autor, é a da opção:

a) Grifinoria (Lufa) sonserina, Dumbledore, 1929 (Potter, 2002).

b) Lufa grifinoria (Dumbledore, 1929) Potter 2002.

c) Lufa sonserina (Dumbledore, 1929).

d) Grifinoria lufa, Potter 2002.

15. (UECE) No que diz respeito à evolução e à estrutura das células procariotas, assinale a afirmação correta.

a) A E. coli é a mais comum e mais bem estudada eubactéria.

b) As eubactérias e arqueobactérias habitam o solo, a superfície das águas e os tecidos de outros organismos vivos ou em decomposição.

c) As eubactérias foram mais recentemente descobertas e menos caracterizadas bioquimicamente. A maioria habita os ambientes mais extremos – águas salgadas, águas quentes, pântanos e regiões profundas dos oceanos.

d) Evidências disponíveis sugerem que a arqueobacteria e a eubactéria convergiram precocemente na evolução e, por isso, constituem um único domínio denominado arqueo.

16. (IFMT) O lêvedo, usado na fabricação de bebidas alcoólicas, a trufa muito apreciada na culinária, o bolor do pão usado em pesquisas genéticas são na verdade:

a) Algas.

b) Bactérias.

c) Protozoários.

d) Fungos.

e) Vírus.

17. (UniEvangélica-Anápolis) Leia o texto a seguir.

O termo alga é utilizado pelos biólogos para designar organismos eucarióticos fotossintetizantes, com organização corporal simples, que vivem no mar, em lagos, em rios ou em superfícies úmidas. Protozoários designa um grupo de organismos unicelulares heterotróficos, que vivem em água doce ou salgada, em ambientes úmidos ou mesmo no interior do corpo de animais, tanto invertebrados quanto vertebrados, causando-lhes doenças. Os fungos têm nutrição heterotrófica, a maioria das espécies vive no solo, onde se alimentam de cadáveres de animais, de plantas e de outros seres vivos.

AMABIS, José Mariano; MARTHO, Gilberto Rodrigues. Fundamentos da Biologia Moderna. Vol. único. 4. ed. São Paulo: Moderna, 2006. p. 280. (Adaptado)

É uma característica comum entre algas, protozoários e fungos:

a) São multicelulares.

b) Fabricam seu próprio alimento.

c) Apresentam membrana nuclear.

d) São procariontes.

18. Espera-se encontrar maior grau de semelhança entre organismos pertencentes a um (a) mesmo (a):

a) classe.

b) família.

c) filo.

d) gênero.

e) ordem.

19. (PUC-SP) O filo Protozoa é subdividido em quatro classes: Sarcodínea, Mastigophora, Sporozoa e Ciliophora. A característica considerada para tal classificação é:

a) o modo de reprodução.

b) a presença ou ausência de carioteca.

c) a composição química do pigmento fotossintetizante.

d) a estrutura de locomoção.

e) a composição química do citoplasma.

20. (UFRGS) A árvore filogenética a seguir, que é baseada em dados moleculares, reúne num mesmo grupo os grandes felinos. O nó 2 reúne as espécies que rugem; o nó 3, as que não têm essa capacidade.

Com relação a essa árvore filogenética, é correto afirmar que

a) a Panthera Leo é mais aparentada com a pantera-nebulosa do que com o tigre.

b) os felinos rugidores surgiram depois dos não-rugidores.

c) as panteras-nebulosas representam o gênero Panthera, que não tem a capacidade de rugir.

d) cada nó representa um evento de especiação por anagênese.

e) O leão e o leopardo compartilham mais características entre si do que a onça e o leopardo.

Publicado por: Djalma Santos | 11 de maio de 2017

TESTES DE GENÉTICA (XX)

01. (UPE) Estudando para um processo avaliativo, cinco amigos discutiam sobre características genéticas. Observe o diálogo vivido entre eles.

Assinale a alternativa que conclui, de forma correta, os argumentos e questionamentos acima.

a) A característica dominante predomina, se a frequência do alelo na população também for alta.

b) A característica recessiva ou dominante pode ser mascarada por interações com o ambiente.

c) O grupo que servia de amostra era muito pequeno para se chegar a alguma conclusão sobre padrões de herança.

d) A característica recessiva ocorre em casamentos consanguíneos, o que poderia mascarar os resultados.

e) O grupo não considerou o sexo que poderia estar influenciando as características.

02. (UECE) De acordo com a pesquisadora Rosana Nogueira Pires da Cunha (2000), não existe uma única causa para a miopia. Nesse sentido, a etiologia dessa doença pode ser genética ou ambiental, sendo, segundo a autora, três fatores importantes para o seu desenvolvimento: relação entre o esforço visual para perto e uma fraca acomodação; predisposição hereditária e relação entre a pressão intraocular e debilidade escleral. Quanto à predisposição hereditária, a miopia autossômica recessiva é característica de comunidades com alta frequência de consanguinidade, estando também relacionada a alguns casos esporádicos. Em três gerações de uma amostra da população chinesa analisada, pesquisadores estabeleceram que o desenvolvimento da miopia segue um modelo poligênico e multifatorial, no qual a influência genética permanece constante, enquanto a influência ambiental mostra-se aumentada nas três últimas gerações.

(Rosana Nogueira Pires da Cunha, Myopia in children. Arq. Bras. Oftalmol. vol.63, nº3. São Paulo, Junho, 2000).

No caso de miopia autossômica recessiva, a probabilidade de nascer uma criança míope de um casal normal, heterozigoto para essa forma de predisposição hereditária para a miopia é de:

a) 0,25.

b) 0,75.

c) 0,45.

d) 0,50.

03. (UniEvangélica-Anápolis) Leia o texto a seguir.

O conjunto de características morfológicas dos cromossomos de uma célula constitui seu cariótipo e o tamanho, a forma e o número dos cromossomos são constantes entre os indivíduos de mesma espécie. Desvios em relação ao cariótipo normal são conhecidos como alterações ou aberrações cromossômicas e geralmente causam transtornos ao funcionamento celular, produzindo alterações morfológicas e fisiológicas. Um exemplo é a alteração cromossômica que resulta na síndrome de Klinefelter, em humanos. Na síndrome de Klinefelter os homens têm estatura média geralmente maior que a média, órgãos genitais pouco desenvolvidos e desenvolvimento das mamas, entre outras características.

GRIFFITHS, Anthony. J. F. et al. Introdução à genética. 9. ed. Rio de Janeiro, Guanabara Koogan, 2008. p. 473.

A constituição cromossômica na síndrome de Klinefelter é representada por:

a) 22AA + XXY ou 47, XXY.

b) 22AA + X ou 45, X0.

c) 22AA + XXX ou 47, XXX.

d) 22AA + XYY ou 47, XYY.

04. (PUC-GO)   O outro

Ele me olhou como se estivesse descobrindo o mundo. Me olhou e reolhou em fração de segundo. Só vi isso porque estava olhando-o na mesma sintonia. A singularização do olhar. Tentei disfarçar virando o pescoço para a direita e para a esquerda, como se estivesse fazendo um exercício, e numa dessas viradas olhei rapidamente para ele no volante. Ele me olhava e volveu rapidamente os olhos, fingindo estar tirando um cisco da camisa. Era um ser de meia idade, os cabelos com alguns fios grisalhos, postura de gente séria, camisa branca, um cidadão comum que jamais flertaria com outra pessoa no trânsito. E assim, enquanto o semáforo estava no vermelho para nós, ficou esse jogo de olhares que não queriam se fixar, mas observar o outro espécime que nada tinha de diferente e ao mesmo tempo tinha tudo de diferente. Ele era o outro e isso era tudo. É como se, na igualdade de milhares de humanos, de repente, o ser se redescobrisse num outro espécime. Quando o semáforo ficou verde, nós nos olhamos e acionamos os motores.

(GONÇALVES, Aguinaldo. Das estampas. São Paulo: Nankin, 2013. p. 130.)

“Era um ser de meia idade, os cabelos com alguns fios grisalhos…”

O trecho acima retirado do texto “O outro”, faz referência a cabelos grisalhos. Sabe-se que a cor dos cabelos varia de acordo com os diferentes níveis do pigmento melanina. Cabelos naturais são, basicamente, castanhos, loiros, ruivos e pretos, e podem, por meios artificiais, atingir tonalidades variadas da cor natural e até mesmo mudar a sua cor original. Marque a alternativa correta:

a) Quando um indivíduo loiro tinge o seu cabelo na cor marrom, sua nova aparência caracteriza um novo genótipo se comparada à aparência de sua cor natural.

b) A deficiência de melanina nos cabelos ocorre apenas nos casos de envelhecimento.

c) Denominamos fenótipo a carga genética de um indivíduo para determinada característica.

d) O albinismo é uma condição genética que determina uma deficiência de melanina no organismo e, dentre outras características, a alteração de pigmento nos cabelos.

05. (UNIOESTE) Em coelhos são conhecidos genes polialelos para a cor do pelo: C ( selvagem); cch (chinchila); ch (himalaia) e ca (albino). A ordem de dominância de um gene sobre outro ou outros é a mesma em que foram citados. Quando foi cruzado um selvagem com um himalaia, obteve-se 1/2 selvagem e 1/2 himalaia. Diante destes dados, pode-se afirmar que:

01. Os genótipos parentais são chch x CC.

02. Os genótipos parentais são Cch x CC.

04. Os genótipos parentais são Ccch x cchch.

08. Os genótipos parentais são Cca x Cch.

16. Os genótipos parentais são Cch x Cch.

32. Os genótipos parentais são Cch x chch.

Soma das alternativas corretas:

06. (UEM) A acondroplasia é uma forma de nanismo provocada por um distúrbio de crescimento, devido a uma deficiência de ossificação. A altura média dos adultos afetados é de 130 cm para homens e de 120 cm para mulheres. Praticamente todos os indivíduos acondroplásicos são heterozigotos. Parte dos homozigotos conhecidos são gravemente afetados e falecem precocemente. Interpretando as informações dadas e com base nos conhecimentos de genética, assinale a(s) alternativa(s) correta(s).

01. A acondroplasia é uma anomalia genética condicionada por um alelo dominante.

02. O alelo para acondroplasia é letal quando em homozigose.

04. Os genes letais podem ser dominantes ou recessivos.

08. A probabilidade de um casal acondroplásico ter uma criança heterozigota é de 1/4.

16. Um casal heterozigoto tem 25% de chance de ter uma criança homozigota dominante.

Soma das alternativas corretas

07. (IFG)

Disponível em: <http://noticias.r7.com/rio-de-janeiro/cerca-de-30- perfis-de-rede-social-serao-investigados-por-ataques-racistas-a-atriztais- araujo-12112015>. Acesso em: 25 nov. 2015.

A manchete acima veiculada na mídia retrata o racismo velado e covarde no Brasil. Parece que mesmo a ciência explicando, não se faz entender para muitos. A cor da pele negra ou branca, nada mais é do que a variação na quantidade de melanina, proteína que protege a pele dos raios solares, principalmente dos ultravioleta (UV). Já é provado pela ciência que a espécie humana moderna nasceu na África, região onde a insolação é intensa e os humanos precisaram se proteger da radiação solar. Isso estimulou genes a produzirem melanina para proteção da pele e do organismo. Com a saída do homem da África para outros continentes, onde a radiação solar é reduzida, os genes foram pouco estimulados e produziram menos melanina, deixando a pele desses grupos de humanos mais clara. Isso define que a espécie humana é uma só, Homo sapiens, não havendo diferença entre negros e brancos, apenas diferença na quantidade de melanina produzida. No Brasil, a população é mais negra do que branca. Os colonizadores brancos europeus cruzaram com os negros africanos durante e após o período de escravidão, dando origem a uma população de “mulatos”. Isso porque os genes, que são mais ativos na produção de melanina, são dominantes em relação aos que são menos ativos. Podem-se verificar as variações da cor da pele humana com um simples exercício de genética, que se segue. A herança da cor da pele em humanos é um tipo de interação gênica denominada quantitativa ou poligênica. De uma forma mais simples, podemos explicar que ela é controlada por dois pares de genes AaBb, que podem formar cinco fenótipos diferente: Negro; Mulato Escuro; Mulato Médio; Mulato Claro e Branco. Sendo assim, um casal de negros heterozigotos para os dois pares de genes, poderão ter filhos com os seguintes fenótipos para a cor da pele:

a) Negro, mulato escuro, mulato médio, mulato claro, branco.

b) Negro, mulato escuro, mulato médio, mulato claro.

c) Negro, mulato escuro, mulato médio.

d) Negro, mulato escuro.

e) Negro, branco.

08. (UERJ) Sabe-se que a transmissão hereditária da cor das flores conhecidas como copos-de-leite se dá por herança mendeliana simples, com dominância completa. Em um cruzamento experimental de copos-de-leite vermelhos, obteve-se uma primeira geração – F1 – bastante numerosa, numa proporção de 3 descendentes vermelhos para cada branco (3:1). Analisando o genótipo da F1, os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. De acordo com tais dados, pode-se afirmar que a proporção genotípica da F1 desse cruzamento experimental foi:

a) 4 Aa

b) 2 Aa : 2 aa

c) 3 AA : 1 Aa

d) 1 AA : 2 Aa : 1

09. (INSTITUTO FEDERAL FARROUPILHA) Marque a alternativa correta sobre os fundamentos da hereditariedade estabelecidos no início do Século XX.

a) Filhos herdam dos pais as características; os genes são transmitidos por gametas; os genes ocorrem aos pares em cada indivíduo (um de origem materna e outro de origem paterna); as duas versões de cada gene (recebida uma da mãe e outra do pai) são denominadas alelos.

b) Filhos adquirem as características do ambiente; os genes são transmitidos por partenogênese; os genes ocorrem aos pares em cada indivíduo (um de origem materna e outro de origem paterna); as duas versões de cada gene (recebida uma da mãe e outra do pai) são denominadas alelos.

c) Filhos herdam as características do ambiente; os genes são transmitidos por gametas; os genes ocorrem aos pares em cada indivíduo (um de origem materna e outro de origem paterna); existe apenas uma versão de cada gene denominada alelo.

d) Filhos herdam dos pais as características; os genes são transmitidos por gametogênese; os genes ocorrem aos pares em cada indivíduo (todos de origem materna devido o citoplasma ser do óvulo); as duas versões de cada gene (recebidas da mãe) são denominadas alelos.

e) Filhos herdam as características do ambiente; os genes são transmitidos por propagação; os genes são individuais em cada indivíduo; as duas versões idênticas de um gene são denominadas alelos.

10. (FAMERP) Analise o heredograma, no qual os indivíduos afetados por uma característica genética estão indicados pelos símbolos escuros.

Considerando que tal característica é condicionada por apenas um par de alelos autossômicos, é correto afirmar que:

a) Os indivíduos 2, 3 e 8 apresentam genótipo dominante.

b) Os indivíduos 1, 4, 7, 12 e 13 apresentam genótipo recessivo.

c) Nenhum dos indivíduos do heredograma apresenta genótipo recessivo.

d) Nenhum dos indivíduos do heredograma apresenta genótipo homozigoto dominante.

11. (UNICENTRO) Em uma espécie animal, um determinado caráter é causado por um gene autossômico recessivo. Com base nessa informação, assinale a alternativa que apresenta, corretamente, a probabilidade de os espermatozoides formados por um macho heterozigoto possuírem o referido gene recessivo.

a) 25%.

b) 30%.

c) 50%.

d) 75%.

e) 100%.

12. (UDESC) Sabendo-se que durante a meiose ocorre a separação dos cromossomos homólogos (cromossomos com mesma forma e tamanho, sendo um paterno e outro materno), considere então apenas quatro pares destes cromossomos homólogos em uma espermatogônia que inicia a meiose. A possibilidade de um indivíduo formar um espermatozoide que possua apenas cromossomos de origem paterna é de:

a) 35%.

b) 12,5%.

c) 50%.

d) 6,25%.

e) 100%.

13. (UPF) A fibrose cística é uma doença autossômica recessiva grave. É caracterizada por um distúrbio nas secreções das glândulas exócrinas que pode afetar todo o organismo, frequentemente levando à morte prematura. As pessoas nas quais o alelo recessivo é detectado recebem aconselhamento genético a respeito do risco de vir a ter um descendente com a doença. Paulo descobriu que é heterozigoto para essa característica. Ele é casado com Júlia, que não apresenta a doença e é filha de pais que também não apresentam a doença. No entanto, Júlia teve um irmão que morreu na infância, vítima de fibrose cística. Qual a probabilidade de que Paulo e Júlia venham a ter um(a) filho(a) com fibrose cística?

a) 1/6.

b) 1/8.

c) 1/4.

d) 1/2.

e) 1/3.

14. (UNIMONTES) Para que determinadas doenças sejam manifestadas, são necessárias duas cópias do gene alterado. Normalmente, os pais não manifestam a doença, mas são ambos portadores desse gene alterado e os progenitores (não afetados pela doença) tem uma probabilidade de 25% de terem um descente portador da doença. Analise as alternativas abaixo e assinale a mais relacionada com as características apresentadas anteriormente.

a) Herança autossômica dominante.

b) Herança autossômica recessiva.

c) Malformação congênita.

d) Doenças ligadas ao cromossoma X.

15. (UERN) A Lipodistrofia Generalizada Congênita (Síndrome de Berardinelli-Seip) é uma síndrome hereditária rara de causa indeterminada, com transmissão autossômica recessiva. O diagnóstico pode ser feito ao nascer ou durante a infância, e o seu portador pode apresentar alterações metabólicas, clínicas e laboratoriais que incluem: diminuição ou ausência de tecido adiposo subcutâneo, crescimento acelerado com padrão acromegaloide (mãos e pês longos, desenvolvimento somático e esquelético acentuado), hipertricose, hiperglicemia, entre outras. É correto afirmar que essa síndrome é um exemplo de:

a) Epistasia.

b) Poligenia.

c) Pleiotropia.

d) Herança quantitativa.

16. (UPF) Considere as afirmativas abaixo sobre as possíveis interações entre alelos de um mesmo gene, assinalando com V as verdadeiras e com F as falsas.

(  ) Dominância incompleta é o termo utilizado para descrever situações em que os indivíduos heterozigotos apresentam fenótipo intermediário entre os fenótipos dos parentais homozigotos.

(  ) Quando o fenótipo dos indivíduos heterozigotos for igual ao fenótipo de um dos parentais homozigotos, esse tipo de interação alélica é denominado codominância.

(  ) Ocorre dominância completa quando ambos os alelos de um lócus são expressos.

( ) Denomina-se polialelia ou alelos múltiplos o fenômeno em que um gene condiciona ou influencia mais de uma característica.

( ) Denomina-se pleiotropia quando um gene apresenta mais de dois alelos diferentes na população.

A sequência correta de preenchimento dos parênteses, de cima para baixo, é:

a) V – F – F – V– F.

b) F – V – V – F– V.

c) V – F – F – F– F.

d) F – F – V – V – F.

e) V – V – F – F– F.

17. (FCM.PB) A fibrose cística é uma doença pulmonar crônica, com insuficiência pancreática exócrina, aumento da concentração de cloreto no suor, mais comum em crianças brancas, exigindo tratamento clínico em longo prazo e sendo geralmente fatal até a 4ª década de vida. A partir do heredograma abaixo, faça uma análise genética da doença e marque a afirmativa correta quanto a herança sugerida.

a) Autossômica dominante.

b) Ligada ao Y.

c) Dominante ligada ao X.

d) Recessiva ligada ao X.

e) Autossômica recessiva.

18. (URCA) Assinale a alternativa correta a respeito de conceitos genéticos:

a) Heredogramas são representações gráficas das relações de parentesco entre indivíduos de uma mesma família.

b) Podemos afirmar que o genótipo é o resultado da interação entre o fenótipo e o ambiente.

c) Cruzamentos-teste são utilizados primordialmente para determinação de fenótipos.

d) De cruzamentos entre indivíduos com fenótipos dominantes não ocorrem descendentes com fenótipo recessivo no monohibridismo.

e) Um homem de sangue tipo A com uma mulher de sangue tipo B não terão filhos de sangue tipo O.

19. (UEG) Uma investigação genética pode começar com a observação de uma variação detectada na morfologia ou fisiologia, isto é, um fenótipo variante. O fenótipo da calvície é um desses, sendo expresso distintamente em homens e mulheres: dominante nos homens e recessivo nas mulheres. Esse tipo de evento ocorre, por exemplo, devido à presença de hormônios sexuais em taxas diferentes nos dois sexos e independe de o gene C se localizar em cromossomo sexual ou autossômico, conforme se observa a seguir.

O padrão de calvície é uma herança:

a) Restrita ao sexo.

b) Influenciada pelo sexo.

c) Autossômica dominante.

d) Autossômica recessiva.

20. (X Olimpíada Brasileira de BIOLOGIA) Observe a figura abaixo que representa algumas conclusões de Mendel e responda esta questão:

Fonte:http://www.sobiologia.com.br/conteudos/Genetica

Com base na figura acima, marque a alternativa correta:

a) cruzando ervilhas com vagens lisas sempre nascerão ervilhas com vagens lisas.

b) na característica cor da semente os indivíduos homozigotos são somente verdes.

c) na característica forma da semente indivíduos rugosos são somente homozigotos.

d) cruzando ervilhas com flores brancas entre si podem nascer indivíduos com flores púrpuras.

e) o fato das vargens verdes serem dominantes indica que sua ocorrência é mais frequente do que a de vagens de cor amarela.

Publicado por: Djalma Santos | 11 de maio de 2017

TESTES SOBRE EVOLUÇÃO (12)

01. (PUCRS) A figura abaixo apresenta a variação das taxas anuais de sobrevivência de Geospiza fortis, nas ilhas Galápagos, em função da altura do bico, em anos de forte seca, os quais ocasionaram a redução de cerca de 85% da população.

01

Krebs, 2001 (dados aproximados).

Com base na interpretação da figura e em conhecimentos de biologia evolutiva, afirma-se:

I. Os indivíduos com maior altura de bico apresentaram maior sobrevivência.

II. A sobrevivência diferencial de fenótipos se caracteriza como o aspecto focal da teoria evolutiva de Darwin.

III. O gráfico exemplifica um processo seletivo do tipo estabilizador ou centralizador.

Está/Estão correta(s) a(s) afirmativa(s):

a) I, apenas.

b) III, apenas.

c) I e II, apenas.

d) II e III, apenas.

e) I, II e III.

02. (UCS) Em um novo estudo, publicado no Scientific Reports, cientistas afirmam ter encontrado um peixe que caminha como um anfíbio. Pesquisadores do Instituto de Tecnologia de Nova Jersey encontraram a espécie rara escalando cachoeiras na Tailândia. Essas características não são vistas em nenhum outro peixe vivo e trazem novas evidências sobre a evolução das espécies.

02

Ao examinar a Cryptotora thamicola, os pesquisadores constataram que o peixe alternava os passos das “patas” traseiras com as frontais, realizando o mesmo movimento que os animais que andam sobre a terra. Além disso, a equipe conseguiu realizar uma impressão 3D da anatomia do peixe, revelando detalhes de seu esqueleto. Nos peixes comuns, a pélvis é composta por pequenos ossos e é utilizada apenas para evitar que eles girem em torno de si, servindo como um instrumento de equilíbrio. Na Cryptotora thamicola, no entanto, verificou-se que a pélvis é uma região complexa, com muitos ossos que são interligados com a espinha. Isso revelou a aproximação dessa espécie com os tetrápodes, que desenvolveram adaptações para conseguir caminhar firmemente sobre a superfície da terra. Esse processo dependeu da evolução da pélvis, que se conectou com a espinha e membros para garantir o movimento das patas, como se vê nas salamandras e em outros anfíbios. Seguindo um padrão evolucionista, os tetrápodes surgiram de uma única linhagem de peixes que conseguiu habitar o solo, utilizando o mesmo movimento alternado de patas – visto na rara espécie de peixe. “Esses resultados são significativos uma vez que representam o primeiro exemplo de adaptações comportamentais e morfológicas em um peixe vivo, que converge com as características apresentadas pelos tetrápodes”, explicou a equipe internacional de pesquisadores responsável pela descoberta.

Disponível em: <http://novataxa.blogspot.com.br/2016/03/cryptotora.html&gt;.

Disponível em: <http://veja.abril.com.br/ciencia/conheca-o-peixe-que-caminha-como-um-anfibio/&gt;. Acesso em: 10 ago. 16. (Parcial e adaptado.)

Tendo como referência as informações apresentadas no texto, assinale a alternativa correta.

a) O nome científico do “peixe que caminha como um anfíbio”, de acordo com o modelo de Lineu, é binominal, e Cryptotora é seu epíteto específico.

b) O isolamento geográfico nas cachoeiras da Tailândia permitiu que a população de Cryptotora thamicola divergisse em características anatômicas de seus ancestrais tetrápodes.

c) O Siluriano é o período da Era Paleozoica compreendido aproximadamente entre 440 e 400 milhões de anos atrás. Nele ocorreu a proliferação dos peixes que dominaram de vez os ambientes aquáticos, motivo pelo qual é conhecido como “A Era dos Peixes”.

d) O grupo dos tetrápodes compreende os anfíbios, os répteis, as aves e os mamíferos que, além de coluna vertebral segmentada e crânio, possuem simetria bilateral.

e) O fato de a Cryptotora thamicola conseguir caminhar como um anfíbio é uma consequência direta de um processo evolutivo não aleatório conhecido como deriva genética.

03. (UNICENTRO) A especiação via isolamento geográfico é um dos modos de multiplicação de espécies. A área que compreende a distribuição geográfica da espécie na população original pode fragmentar-se devido a alterações ambientais, por exemplo, climáticas. Supõe-se que na floresta tropical da Amazônia, um período de seca no passado resultou no recuo da floresta, que se transformou numa série de “ilhas” distintas que efetivamente isolaram muitas populações de seus vizinhos originais. Uma vez isoladas, estas populações se adaptaram às condições locais. Após um período de tempo não determinado, espécies novas poderão ter surgido e esse fato é ratificado:

a) pela origem de estruturas anatômicas distintas.

b) pela origem de indivíduo com tamanhos diferentes.

c) pela preferência distinta a alguns alimentos.

d) pelo isolamento reprodutivo que ocorre entre as diferentes populações.

04. (UEPG) Darwin, em sua teoria, considerou a existência de um parentesco generalizado entre as espécies, fato que obteve pouca aceitação em sua época. Para ele, as espécies estavam relacionadas evolutivamente, ou seja, compartilhavam um ancestral em algum ponto da sua história evolutiva. Assinale o que for correto em relação à teoria da seleção natural, os maiores problemas enfrentados por Darwin em sua época, ou fatos que não soube explicar.

01. Darwin errou ao descrever que os indivíduos de uma população diferem quanto a diversas características, inclusive aquelas que influem na capacidade de explorar com sucesso os recursos naturais e de deixar descendentes. Atualmente, é conhecido que todos os indivíduos das populações biológicas têm a mesma chance de sobrevivência e reprodução.

02. A teoria da herança por mistura, teoria de herança genética aceita na época, apresentava forte argumento contra o chamado Darwinismo. De acordo com a teoria da herança por mistura, uma nova característica, mesmo vantajosa, tenderia a se misturar com a característica antiga ao longo das gerações.

04. Os principais argumentos contra a teoria da seleção natural de Darwin era o pleno conhecimento da comunidade científica da época das leis de Mendel, da mutação e da recombinação genética.

08. O principal problema das propostas de Darwin era a falta de teorias que explicassem a origem e a transmissão das variações para dar um embasamento à teoria da seleção natural.

16. Em sua teoria, Darwin afirmou que a seleção natural é um processo aleatório, sem o favorecimento de uma variante fenotípica. Darwin também descreveu em sua teoria que a variabilidade genética de uma população é resultado dos processos de mutação e recombinação.

Soma das alternativas corretas:

05. (Unespar) “A origem das espécies” de Charles Darwin foi um dos maiores avanços das Ciências biológicas de todos os tempos, a ponto de ser dito que “nada na biologia faz sentido exceto à luz da evolução” (DOBZHANSKY, T. Biology, Molecular and Organismic. American Zoologist, v. 4, p. 443-452, 1964). No entanto, ainda hoje, há certa confusão sobre como se processa a evolução, mesmo entre os estudantes de Ciências Biológicas. Assim, assinale a única alternativa que não condiz com as ideias de Darwin.

a) Darwin referiu-se à evolução como: um processo de descendência com modificações.

b) Os organismos de uma mesma população não são idênticos, mas apresentam variações nos caracteres.

c) Todos os organismos descendem, com modificações, de ancestrais comuns.

d) Modificações do corpo dos organismos, adquiridas durante sua vida pelo uso ou desuso, são transmitidas aos seus descendentes.

e) A ação da seleção natural é a principal agente de modificações das variações individuais dos organismos.

06. (UEL) No início do século XIX, alguns naturalistas passaram a adotar ideias evolucionistas para explicar a diversidade do mundo vivo. Embora os teólogos naturais tivessem reconhecido a importância do meio ambiente e as adaptações dos organismos a ele, Jean-Baptiste Lamarck foi o primeiro a reconhecer a importância crucial do tempo para explicar a diversidade da vida. Assinale a alternativa que apresenta, corretamente, uma contribuição de Lamarck para o pensamento evolucionista da época, além do fator tempo.

a) Uma vez que, a cada geração, sobrevivem os mais aptos, eles tendem a transmitir aos descendentes as características relacionadas a essa maior aptidão para sobreviver.

b) Os indivíduos que sobrevivem e se reproduzem, a cada geração, são os que apresentam determinadas características relacionadas com a adaptação às condições ambientais.

c) Algumas características conferem a seus portadores vantagens para explorar o meio ambiente de forma a tornar a sobrevivência e a reprodução mais eficientes.

d) A variação casual apresenta-se em primeiro lugar e a atividade ordenada do meio ambiente vem posteriormente, ou seja, a variação independe do meio.

e) A adaptação é o inevitável produto final de processos fisiológicos requeridos pelas necessidades dos organismos de fazer face às mudanças de seu meio ambiente.

07. (Unisinos) De acordo com a Síntese Evolutiva Moderna (Neodarwinismo), vários fatores podem in­fluenciar o conjunto gênico de uma popula­ção. Esses fatores podem aumentar a varia­bilidade genética da população ou agir sobre as variações da população. Das alternativas abaixo, qual é composta apenas por fatores que atuam sobre a variabilidade genética já estabelecida na população?

a) Seleção natural e migração.

b) Mutação gênica e seleção natural.

c) Mutação gênica e recombinação.

d) Seleção natural e recombinação.

e) Migração e recombinação.

08. (UDESC) Dentre os fatores evolutivos, a deriva genética é um dos mais interessantes por suas características. Analise as proposições sobre este fator evolutivo.

I. A deriva genética aumenta as frequências de mutações em uma população.

II. Para ocorrer a deriva genética é necessário o mesmo número de machos e fêmeas em uma população.

III. A deriva genética ocorre em populações pequenas.

IV. A deriva genética aumenta a variabilidade gênica de uma população.

Assinale a alternativa correta.

a) Somente a afirmativa III é verdadeira.

b) Somente a afirmativa IV é verdadeira.

c) Somente as afirmativas I e IV são verdadeiras.

d) Somente as afirmativas II e III são verdadeiras.

e) Somente as afirmativas III e IV são verdadeiras.

09. (UNIPAR) A expansão e o domínio dos répteis durante a Era Mesozoica, incluindo o aparecimento dos dinossauros e sua ampla distribuição em diversos nichos do ambiente terrestre, podem ser atribuídos corretamente ao seguinte motivo:

a) As inúmeras vantagens sobre os anfíbios na competição pelo alimento.

b) O cuidado mais prolongado com a prole, garantindo proteção contra os predadores naturais.

c) O aparecimento de ovo com casca, capaz de evitar o dessecamento.

d) A extinção dos predadores naturais e consequente explosão populacional.

e) A abundância de alimento nos ambientes aquáticos abandonados pelos anfíbios.

10. (ACAFE) Origem evolutiva

Um fóssil com apenas 11 centímetros de comprimento e 250 milhões de anos pode ajudar a explicar a origem evolutiva de diversos grupos animais, como dinossauros, pterossauros (repteis voadores), aves e jacarés. O exemplar foi encontrado no município de São Francisco de Assis (RS) por uma equipe de cientistas de três universidades brasileiras: Universidade Federal do Pampa (Unipampa), Universidade Federal do Rio Grande do Sul (UFRGS) e Universidade do Vale do São Francisco. Os resultados de estudos sobre o material foram publicados na última semana no periódico cientifico Scientific Reports, do grupo Nature.

Fonte: Ciência Hoje, 14/03/2016.Disponível em: http://cienciahoje.uol.com.br

Nesse sentido, analise as afirmações a seguir e marque V para as verdadeiras e F para as falsas.

( ) De acordo com o darwinismo, as espécies são diferentes entre si, devido ao processo de mutação. As que forem aptas ou demonstrarem mais facilidade em sobreviver a determinados ambientes, se multiplicam, evoluem e seus descendentes serão os dominadores daquela região. Esse princípio é denominado seleção natural.

( ) De acordo com o Neodarwinismo, a mutação é o principal fator evolutivo, visto que sempre ocorre para que os indivíduos se adaptem melhor a um determinado ambiente.

( ) De acordo com a Teoria Sintética da Evolução, a seleção natural é apenas um dos mecanismos evolutivos conhecidos. Deriva genética, mutação, recombinação e fluxo genético são os outros, podendo agir de forma a reduzir ou aumentar a variação genética.

( ) Além dos fósseis, os órgãos vestigiais, a embriologia comparada, a semelhança na estrutura molecular de diversos organismos, a homologia e a analogia são evidências e provas da Teoria da Evolução.

( ) A visão evolutiva explica que espécies semelhantes apresentam parentesco e originaram-se de antepassados comuns.

A sequência correta, de cima para baixo, e:

a) V – V – F – V – F.

b) F – V – F – F – V.

c) F – F – V – V – V.

d) V – F – V – F – V.

11. (Mackenzie) O avanço da medicina é responsável pelo aumento da expectativa de vida de muitas pessoas portadoras de genes que causam doenças graves. Assim, podemos dizer que a medicina:

a) vai contra a seleção natural, prejudicando a permanência da espécie humana.

b) vai contra a seleção natural, favorecendo a permanência da espécie humana.

c) vai contra o processo de mutação, prejudicando a permanência da espécie humana.

d) tem sido favorável à seleção natural, sendo positiva para a permanência da espécie humana.

e) tem sido favorável à ocorrência da mutação, favorecendo a permanência da espécie humana.

12. (UFJF) Recentemente, uma nova espécie de caramujo aquático foi descrita para a América do Norte. Os pesquisadores estavam estudando o que acreditavam se tratar de duas populações de uma espécie bem conhecida, quando observaram que os indivíduos da população “A” apresentavam características morfológicas diferentes daquelas observadas nos indivíduos da população “B”. Para confirmar que a população ‘A’ representava uma nova espécie, os pesquisadores analisaram e compararam o DNA dos indivíduos provenientes das duas populações e provaram, através de experimentos de laboratório, que esses indivíduos não são capazes de se acasalar. As diferenças observadas no DNA e o fato de os indivíduos das duas populações não terem acasalado e, portanto, não gerarem descendentes férteis foram interpretados pelos cientistas como provas de que essas duas populações correspondem a duas espécies diferentes.

I. O mecanismo de isolamento reprodutivo entre as populações de caramujos poderia ser do tipo pré-zigótico, já que os indivíduos não foram capazes de se acasalar.

II. Duas populações que se encontram em alopatria podem se tornar espécies diferentes ao longo do tempo devido à manutenção do fluxo gênico.

III. Através de mutações no DNA e ausência de fluxo gênico, alelos diferentes vão sendo fixados nas duas populações levando à formação de duas espécies diferentes.

IV. O isolamento geográfico pode resultar em mudanças no fenótipo, que tornam os indivíduos incompatíveis para a reprodução.

V. O isolamento reprodutivo pode ocorrer em consequência do isolamento geográfico e ausência de fluxo gênico entre populações alopátricas.

Assinale a opção com as afirmativas corretas:

a) somente I, II, V.

b) somente I, II, III, IV.

c) somente I, III, IV, V.

d) somente III, IV, V.

e) I, II, III, IV e V.

13. (UNESP) Na figura estão representados exemplares de peixes, de aves e de mamíferos.

13

As semelhanças de formato dos corpos e dos membros locomotores nos animais representados decorrem:

a) da mutação que ocorre nos indivíduos em resposta às exigências adaptativas de ambientes com diferentes características, o que leva à irradiação adaptativa.

b) da ação da seleção natural atuando sobre indivíduos em ambientes com diferentes características, o que leva à convergência adaptativa.

c) da ação da seleção natural atuando sobre indivíduos em ambientes com as mesmas características, o que leva à convergência adaptativa.

d) da mutação que ocorre casualmente em indivíduos que vivem em ambientes com as mesmas características, o que leva à irradiação adaptativa.

e) da ação da deriva genética, que permite a fixação de diferentes fenótipos em ambientes com diferentes características, o que leva à convergência adaptativa.

14. (UEM) Um fato marcante na evolução humana foi o desenvolvimento da agricultura e da agropecuária. Acredita-se que mamíferos foram domesticados como fonte de reserva de carne e leite. Uma mutação genética teria tornado o adulto humano “tolerante” ao leite, sendo tal mutação selecionada ao longo de gerações, permitindo assim seu consumo e sua digestão pelos adultos. Atualmente, a maioria dos humanos adultos são tolerantes à lactose. Com base no exposto e em assuntos correlatos, assinale o que for correto.

01. O texto aborda o surgimento, por mutação, da enzima galactase em humanos adultos.

02. O texto aborda uma interpretação da teoria sintética da evolução, onde uma modificação casual foi selecionada e mantida na população.

04. O texto aborda o surgimento de uma mutação somática.

08. O texto aborda o surgimento de alterações do código de bases nitrogenadas, originando um alelo que teve sua frequência aumentada na população.

16. O texto aborda os mecanismos de especiação.

Soma das alternativas corretas:

15. (Unitau) O desenvolvimento de novas espécies é denominado, pelos evolucionistas, de especiação. Esse fenômeno pode se dar pelo surgimento de alterações gradativas em uma única espécie, alterando seu genoma e convertendo-a em uma outra espécie. Alternativamente, quando duas populações de uma espécie se tornam reprodutivamente isoladas, acabam por se diferenciar uma da outra, o que resulta em duas espécies distintas. Assinale a alternativa que apresenta, respectivamente, os nomes desses dois processos de especiação.

a) Embriogênese e cladogênese.

b) Angiogênese e cladogênese.

c) Anagênese e angiogênese.

d) Criogênese e angiogênese.

e) Anagênese e cladogênese.

16. (UNICAMP) O cladograma abaixo representa relações evolutivas entre membros da Superfamília Hominoidea, onde se observa que:

16

a) homens e gibões (Hylobatidae) não possuem ancestral comum.

b) homens, gorilas (Gorilla) e orangotangos (Pongo) pertencem a famílias diferentes.

c) homens, gibões e chimpanzés (Pan) possuem um ancestral comum.

d) homens, orangotangos (Pongo) e gibões (Hylobatidae) são primatas pertencentes à mesma família.

17. (Unimontes) Eco-de-extinção é um processo que tem o objetivo de usar o modelo genômico de um organismo extinto como guia para produzir uma população ideal substituta de organismos para assumir o papel ecológico desse organismo extinto. Dessa forma, o dogma central da eco-de-extinção pode ser entendido como: genótipo > fenótipo > ecótipo. A figura abaixo ilustra métodos de extinção. Analise-a.

17

Considerando a figura e o assunto abordado, analise as alternativas abaixo e assinale a afirmativa correta.

a) O produto de eco-de-extinção é uma duplicata de uma espécie extinta e desempenha um papel ecológico igual ao de seus parentes.

b) A adaptação do produto da eco-de-extinção não necessita de interações com outros organismos.

c) O resultado obtido em I pode contribuir para a comunicação social do animal e para confundir predadores.

d) O processo II é considerado hibridização natural.

18. (FUVEST) Os primeiros vertebrados que conquistaram definitivamente o ambiente terrestre foram os (I), que possuem (II), aquisição evolutiva que permitiu o desenvolvimento do embrião fora da água. Indique a alternativa que completa corretamente essa frase.

18

19. (PUC-RIO) A Figura abaixo representa a distribuição geográfica atual de quatro espécies de um gênero de lagartos (A, B, C e D) e sua relação filogenética.

19

Que tipo de especiação é o mais provável de ter ocorrido?

a) Simpátrica.

b) Alopátrica.

c) Parapátrica.

d) Peripátrica.

e) Coespeciação.

20. (UERJ) No processo evolutivo de algumas espécies de primatas, destacam-se diferentes formas de movimentação e de distribuição da musculatura, conforme se observa a seguir.

20

Em relação aos demais primatas, a diferença na distribuição da musculatura da espécie humana favoreceu a seguinte atividade:

a) ocupação das árvores.

b) alimentação herbívora.

c) locomoção quadrúpede.

d) manipulação de objetos.

gab

Publicado por: Djalma Santos | 11 de maio de 2017

TESTES DE BOTÂNICA (6)

01. (UNESP) Na aula sobre morfologia vegetal, os alunos foram levados ao pátio da escola, para analisar um pé de Mussaenda alicia, ou mussaenda-rosa-arbustiva. A professora chamou a atenção dos alunos para algumas características da planta, cuja foto encontra-se a seguir.

01

Além das folhas e do tronco, os alunos observaram estruturas cor-de-rosa e, no interior delas, as amarelas. A partir da observação, levantaram hipóteses sobre tais estruturas. Assinale a alternativa que contém a definição e o argumento corretos para a hipótese levantada.

a) As estruturas rosa são pétalas; pois, por definição, as pétalas são as estruturas chamativas da flor e se observa que, nessa planta, essas são as estruturas mais vistosas.

b) As estruturas rosa são flores; pois, por definição, flores são os órgãos que atraem os polinizadores e tais estruturas são as mais chamativas da planta.

c) As estruturas amarelas são flores; pois, por definição, flores contêm os órgãos reprodutivos da planta e foram observados gineceu e androceu nessas estruturas.

d) As estruturas amarelas são folhas; pois, por definição, folhas protegem os órgãos reprodutivos da planta e foram observados androceu e gineceu internamente a essas estruturas.

e) As estruturas rosa são folhas; pois, por definição, qualquer órgão presente na planta, que não seja raiz, caule ou flor, independentemente de sua coloração, deve ser chamado de folha e tem por função principal realizar fotossíntese.

02. (UEM) As plantas daninhas, quando crescem juntamente com as culturas, interferem no seu desenvolvimento, reduzindo-lhes a produção. Competem pela extração dos elementos vitais: água, luz, CO2 e nutrientes e exercem inibição química sobre o desenvolvimento das plantas. Sobre alguns aspectos fisiológicos das plantas, relacionados a esses elementos, assinale o que for correto.

01. A água, importante em processos fisiológicos como a fotossíntese, é absorvida pelas raízes e transportada pelos elementos do xilema até as folhas.

02.Com relação à absorção de nutrientes, as plantas daninhas são favorecidas pela capacidade de realizarem a fixação de nitrogênio atmosférico nas células das folhas, independentemente da presença de bactérias e de fungos micorrízicos.

04. Os elementos minerais absorvidos do solo são transportados até as folhas onde participam da estrutura celular, como nas proteínas das membranas, e de reações metabólicas, como a fotossíntese.

08. A transpiração, nos vegetais, consiste na perda de água na forma de vapor através dos poros estomáticos e da cutícula, favorecendo a absorção de CO2 atmosférico e de nutrientes.

16. As plantas sintetizam hormônios como as auxinas, as giberelinas e as citocininas, que controlam o crescimento dos caules, das raízes, das folhas e dos frutos.

32. A luz absorvida pelas moléculas de clorofila é a fonte de energia para a produção de carboidratos e, também, influencia no mecanismo de abertura e de fechamento do poro estomático.

Soma das alternativas corretas:

03. (UPE) Os manguezais são florestas inundadas diariamente pelas marés, com árvores adaptadas às variações de salinidade ao longo do dia. Essa incrível adaptação aconteceu há 50 milhões de anos, quando as angiospermas evoluíram a fim de conquistar o ambiente estuarino. Entretanto, outras adaptações foram necessárias à conquista definitiva do ambiente do entremarés. Quanto à reprodução e à dispersão das espécies típicas de mangues, é correto afirmar que produzem.

a) Frutos carnosos que são dispersos por zoocoria.

b) Sementes aladas que são dispersas por anemocoria.

c) Propágulos que são dispersos por hidrocoria.

d) Frutos pequenos que são dispersos por ictiocoria.

e) Diásporos flutuantes que são dispersos pelas marés.

04. (UDESC) Fornecer suporte às folhas e transporte das seivas bruta e elaborada são as principais funções dos caules. Analise as proposições em relação à informação.

I. O caule do tipo volúvel é um caule aéreo, ereto e lenhoso, a exemplo, uva, chuchu e feijão.

II. O caule do tipo colmo é um tipo de caule lenhoso e rastejante no qual são nitidamente observadas as regiões de nó e interno, a exemplo, palmito e coqueiro.

III. O caule do tipo rizoma é um caule subterrâneo com desenvolvimento perpendicular à superfície, a exemplo, batata inglesa, cenoura e aipim.

IV. O caule do tipo bulbo é um caule subterrâneo, de tamanho reduzido e envolvido por folhas modificadas, a exemplo, cebola e alho.

V. O caule do tipo estipe é um caule com muitos galhos e lenhoso, a exemplo, laranjeira e coqueiro.

Assinale a alternativa correta.

a) Na afirmativa IV a descrição do caule está correta, assim como os exemplos deste tipo de caule.

b) Na afirmativa I a descrição do caule está correta, assim como os exemplos deste tipo de caule.

c) Na afirmativa II a descrição do caule está correta, porém os exemplos são de outro tipo de caule.

d) Na afirmativa III a descrição do caule está correta, assim como os exemplos deste tipo de caule.

e) Na afirmativa V a descrição do caule está correta, porém os exemplos não são deste tipo de caule.

05. (UEM) Sobre as flores, assinale a alternativa incorreta.

a) As sépalas, as pétalas, o gineceu e o androceu são partes de uma flor.

b) Nas flores, ocorre a produção de micrósporos e de megásporos.

c) O amadurecimento simultâneo do gineceu e do androceu favorece a autofecundação.

d) Estão presentes em todas as plantas vasculares.

e) Podem ser polinizadas pelo vento, pelos insetos e pelos pássaros.

06. (UFLA) No esquema abaixo, os algarismos indicam as partes vegetativas e as partes reprodutivas de uma flor:

06

Associe as partes I, II, III e IV da flor à sua função.

a. Proteção dos órgãos reprodutores.

b. Formação de grãos de pólen.

c. Deposição dos grãos de pólen.

d. Atração de polinizadores.

Assinale a alternativa que apresenta a sequência correta.

a) I – b II – d III – a IV – c.

b) I – a II – b III – c IV – d.

c) I – b II – a III – c IV – d.

d) I – a II – d III – b IV – c.

07. (PUC-RS) Na reprodução de angiospermas, cada óvulo desenvolve uma semente após a fecundação, e o ovário forma um _________ que encerra as sementes. A semente armazena vários nutrientes, como proteínas, óleos e amido, enquanto o embrião se desenvolve a partir do _________. Inicialmente, esses nutrientes são estocados no _________ da semente.

a) fruto – óvulo – cotilédone

b) fruto – zigoto – endosperma

c) tegumento – óvulo – epicótilo

d) tegumento – zigoto – cotilédone

e) pericarpo – zigoto – endosperma

08. (UFAM) Analise a representação dos tecidos da folha e assinale a alternativa que correlaciona corretamente os elementos numerados:

08

09. (IFMG) As plantas podem ser classificadas em fanerógamas ou criptógamas. No grupo das fanerógamas encontramos as gimnospermas e angiospermas e no grupo das criptógamas, as briófitas e pteridófitas. É característica diferencial entre esses seres vivos:

a) Criptógamas produzem sementes.

b) Fanerógamas produzem grão de pólen e tubo polínico.

c) Fanerógamas produzem gametas flagelados que dependem da água para a locomoção.

d) Fanerógamas apresentam o gametófito como fase duradoura.

10. (FAMERP) Espinhos são encontrados em certas variedades de limoeiros e acúleos são encontrados nas roseiras. É correto afirmar que, nas plantas:

a) os espinhos são anexos epidérmicos e os acúleos são folhas ou ramos modificados e ambos atuam na proteção.

b) os espinhos e os acúleos são ramos modificados e atuam na secreção de substâncias.

c) os espinhos e os acúleos são anexos epidérmicos e atuam na captação de luz.

d) os espinhos e os acúleos são folhas modificadas e atuam na proteção.

e) os espinhos são folhas ou ramos modificados e os acúleos são anexos epidérmicos e ambos atuam na proteção.

11. (ETEC) A agricultura e a arte de colher o sol. Essa frase, divulgada nos cursos de Agronomia, expressa o quanto a agricultura depende de fenômenos e elementos naturais mais do que qualquer outra atividade econômica conhecida. Isso ocorre porque a produção agropecuária depende de uma capacidade especial típica dos vegetais: sintetizar seu próprio alimento. Porém, assim como todos os demais seres vivos, as plantas também precisam de agua e de nutrientes minerais que elas retiram do solo pelas raízes. Entretanto, as plantas podem “fabricar” as substancias orgânicas de que necessitam para sua nutrição e fazem isso por meio de um processo bioquímico chamado de fotossíntese, o qual depende da energia do sol para acontecer.

<http://tinyurl.com/pw336dv&gt; Acesso em: 20.08.2015. Adaptado.

A partir das informações do texto, assinale a alternativa correta.

a) O solo depende da energia do sol e das raízes das plantas para realizar o processo de fotossíntese.

b) A agricultura possui autonomia, pois independe de fenômenos naturais para sua existência.

c) As plantas não dependem, diretamente, de outros seres vivos para produzir o próprio alimento.

d) As sementes das plantas adubam organicamente o solo no processo de fotossíntese.

e) O solo produz os materiais orgânicos e energia para nutrir as plantas e o processo agrícola.

12. (UEM) De maneira geral, as raízes constituem a parte subterrânea das plantas, ao passo que o caule e as folhas formam a parte aérea. Na maioria das plantas adultas, formam-se flores, das quais se originam frutos e sementes. Sobre os tecidos e os órgãos das plantas, assinale o que for correto.

01. Nas raízes e nos caules, ocorrem tecidos meristemáticos responsáveis pelo crescimento em comprimento e em espessura.

02. Os tecidos de condução, de sustentação, de revestimento, além dos parênquimas, são constituídos por células diferenciadas derivadas dos meristemas.

04. Os vasos condutores do xilema (ou lenho) e do floema (ou líber) estão presentes nos caules, nas raízes e nas folhas.

08. Os tecidos parenquimáticos podem executar diferentes funções, como a realização da fotossíntese nas folhas ou o armazenamento de substâncias, como o amido, nas sementes e em determinados tipos de caules e de raízes.

16. A epiderme, que apresenta células com paredes espessas, devido à deposição de lignina, de celulose e de cutina, formando uma cutícula externa, constitui o tecido de revestimento das folhas, dos caules e das raízes.

32. Os vários tipos de caules e de raízes das plantas, embora sejam diferentes, crescem em espessura mantendo constante a estrutura primária das células e dos tecidos.

64. Frutos e sementes são estruturas reprodutivas das plantas decorrentes de mecanismos naturais de reprodução assexuada.

Soma das alternativas corretas:

13. (UEM) Identifique o que for correto sobre uma planta de feijão e outra de milho.

01. O tecido de revestimento das folhas de ambas as plantas é a epiderme.

02. No milho, o caule é aéreo do tipo estipe.

04. As atividades do meristema fundamental e do procâmbio propiciam o crescimento secundário nas duas plantas.

08. O fruto das plantas de milho é classificado como seco, indeiscente do tipo cariopse.

16. No feijão, o sistema radicular é pivotante e a germinação, epígea.

Soma das alternativas corretas:

14. (URCA) Plantas são seres produtores. Ocupam a base das cadeias alimentares na grande maioria dos ecossistemas terrestres. Quando produzem glicose, armazenam está sob a forma de amido. Esse polissacarídeo pode ser encontrado:

a) principalmente nas folhas das plantas.

b) geralmente nas flores.

c) apenas nas raízes.

d) apenas no caule.

e) principalmente em raízes, caules e sementes.

15. (UEPG) O ramo da biologia que estuda as plantas é a botânica. Tradicionalmente, as plantas são divididas e subdivididas conforme as estruturas que apresentam. Em relação a estas divisões, assinale o que for correto.

01. Criptógamas: plantas que têm as estruturas reprodutoras pouco evidentes.

02. Fanerógamas: plantas que possuem estruturas reprodutoras bem visíveis.

04. As criptógamas podem ser divididas em briófitas e pteridófitas.

08. As fanerógamas são divididas em gimnospermas e angiospermas.

16. Por apresentarem vasos condutores de seiva, as pteridófitas e todas as fanerógamas são chamadas de plantas traqueófitas.

Soma das alternativas corretas:

16. (IFG) Os vegetais sofreram uma série de modificações ao longo de sua evolução e cada grupo apresentou algumas características importantes para a adaptação e dispersão pelo ambiente terrestre. A presença de vasos condutores de seiva e fruto surgiu, respectivamente, nos seguintes grupos:

a) Pteridófitas e angiospermas.

b) Gimnospermas e briófitas.

c) Pteridófitas e gimnospermas.

d) Briófitas e pteridófitas.

e) Briófitas e angiospermas.

17. (UEG) Na hipótese de haver alguma substância que funcionasse como uma barreira e impedimento à reprodução dos insetos, alguns grupos de plantas sofreriam uma diminuição na sua população, uma vez que as plantas possuem uma relação direta com alguns insetos. Essa relação inseto-planta se dá porque:

a) a falta de reprodução dos insetos livraria as plantas de doenças e possibilitaria a polinização de angiospermas e briófitas.

b) os insetos livram as plantas de várias doenças, uma vez que são vetores de algumas delas, principalmente de pteridófitas.

c) as plantas, principalmente as briófitas e gimnospermas, dependem dos insetos para a realização da polinização e distribuição do néctar.

d) as plantas dependem dos insetos porque eles são polinizadores e, na ausência da sua reprodução, a polinização não ocorreria e a população de plantas diminuiria.

18. (UDESC) Originalmente, ao longo da evolução das plantas, o principal papel dos frutos é dar proteção às sementes. Posteriormente, ocorreram adaptações que conferiram aos frutos a função de auxiliarem na dispersão das sementes. Para desempenhar estes papéis os frutos desenvolveram uma série de modificações e adaptações em suas estruturas (pericarpo; mesocarpo e endocarpo). Estas modificações servem como meio de classificação para os frutos.

18

Assinale a alternativa que indica a associação correta entre a Coluna I e a II, na Tabela 1.

a) 1 – C; 5 – A; 7 – G.

b) 2 – D; 4 – F; 6 – E.

c) 2 – G; 6 – B; 7 – F.

d) 4 – F; 4 – G; 2 – F.

e) 3 – F; 2 – F; 1 – D.

19. (UCS) Algumas plantas raras da mata atlântica podem ressurgir no laboratório. Algumas sementes com menos de 5% de viabilidade podem sobreviver graças a técnicas “in vitro”. Essas técnicas consistem em:

a) germinar as sementes em substratos orgânicos ricos em NPK, com alta taxa de germinação.

b) germinar algumas sementes em meio com hormônio etileno e propagar através de cultura de células de tecidos secundários.

c) germinar algumas sementes em meio enriquecido com auxina e propagar células meristemáticas com a técnica de cultura de tecidos.

d) retirar o endosperma e multiplicá-lo por técnicas de clonagem celular, utilizando uma célula materna do parênquima.

e) induzir a quebra de dormência com giberelinas e retirar células do tecido suberoso e multiplicá-las em meio de cultura específico.

20. (MACK) Nos diagramas A e B abaixo, estão representados os ciclos de vida de vários grupos de seres vivos.

20

A respeito deles, é correto afirmar que:

a) A ocorre em plantas e B em fungos.

b) A ocorre em fungos e B em plantas.

c) A ocorre em algas e B em fungos.

d) Os dois ocorrem em plantas.

e) Os dois ocorrem em fungos.

21. (FUVEST). O diagrama abaixo representa as relações filogenéticas entre as algas e os principais grupos de plantas atuais. Cada círculo numerado indica uma aquisição evolutiva compartilhada apenas pelos grupos representados nos ramos acima desse círculo. Por exemplo, o círculo 1 representa “embrião dependente do organismo genitor”, característica comum a todos os grupos, exceto ao das algas. Os círculos de número 2, 3 e 4 representam, respectivamente:

21

a) alternância de gerações; fruto; semente.

b) alternância de gerações; tecidos condutores; fruto.

c) tecidos condutores; fruto; flor.

d) tecidos condutores; semente; fruto.

e) semente; flor; tecidos condutores.

22. (MACK)

22

A figura acima representa um estômato encontrado na epiderme inferior da folha de Tradescantia sp. As únicas células dessa estrutura que apresentam cloroplastos são as assinaladas por:

a) 1.

b) 2.

c) 3.

d) 1 e 2.

e) 1 e 3.

23. (PUC-SP) Uma gota d¢água contendo várias algas do gênero Chlamydomonas foi colocada sobre uma lâmina de vidro, a qual ficou perto de uma fonte de luz, conforme o desenho abaixo.

23

Observou-se que as algas se concentraram no lado oposto à fonte luminosa. A seguir, foi colocada uma gota de solução de glicose a 10% sobre o ponto A e observou-se que as algas se concentraram ao redor deste ponto. Com base nestes dados podemos concluir que as Chlamydomonas:

a) apresentam fototropismo negativo e quimiotropismo positivo.

b) apresentam fototropismo positivo e quimiotropismo negativo.

c) apresentam fototactismo positivo e quimiotactismo negativo.

d) são quimiossensíveis, mas não são fotossensíveis.

e) apresentam fototactismo negativo e quimiotactismo positivo.

24. (COVEST) Na figura abaixo, são apresentadas estruturas vegetais, numeradas de 1 a 8. Assinale a alternativa que relaciona estruturas características de angiospermas monocotiledôneas.

24

Está(ao) correta(s):

a) 1, 3, 6 e 8.

b) 2, 3, 6 e 8.

c) 1, 4, 6 e 7.

d) 1, 3, 5, e 7.

e) 2, 4, 5 e 7.

25. (PUC-MG) De acordo com a representação dos grupos vegetais, é correto afirmar que:

25

a) a raiz aparece, pela primeira vez, em representantes de 3.

b) a vascularidade ocorre a partir dos representantes de 4.

c) a fase esporofítica dominante e autotrófica aparece a partir de 2.

d) não há mais nenhuma característica marcante que distinga 5 e 4.

e) flores e frutos secos ocorrem a partir de 4.

26. (PUC-MG) A figura abaixo destaca partes de a estrutura de três diferentes cultivares (vegetais).

26

Com base em seus conhecimentos, é correto afirmar, exceto:

a) Rizoma é uma estrutura encontrada em samambaia e em bananeiras.

b) Turbérculos são raízes que apresentam nódulos ricos em substâncias nutritivas.

c) No bulbo, como os da cebola, folhas modificadas e armazenadoras revestem uma pequena porção caulinar.

d) Rizomas, tubérculos e bulbos são estruturas tipicamente subterrâneas.

27. (UPE) Assinale a alternativa que apresenta, corretamente, frutos considerados do tipo baga, drupa e seco, respectivamente.

a) Laranja – goiaba – milho.

b) Pêssego – abacate – noz.

c) Castanha-portuguesa – morango – soja.

d) Uva – manga – feijão.

e) Abacaxi – maçã – arroz.

28. (COVEST) As raízes e os caules podem armazenar matéria orgânica e, como outros órgãos vegetais, podem ser consumidos e aproveitados economicamente pelo homem. Sobre esse tema, analise as proposições abaixo.

I   II

0  0 –  Nabo, beterraba e mandioca são raízes que se constituem em importantes fontes de alimento para os seres humanos.

1 1 – As raízes tuberosas, como a batata-inglesa (batatinha-comum) e o inhame, são frequentemente confundidas com caules subterrâneos.

2  2 –  O açúcar é um alimento que pode ser obtido a partir de caule ou de raiz.

3 3 – As fibras, importante produto encontrado em vegetais, podem apresentar em sua composição celulose, pectina e lignina.

4  4 – A cebola, o rabanete e a beterraba são caules tipo bulbo, importantes para a alimentação humana.

29. (UNESP) Nos vegetais, estômatos, xilema, floema e lenticelas têm suas funções relacionadas, respectivamente, a:

a) trocas gasosas, transporte de água e de sais minerais, transporte de substâncias orgânicas e trocas gasosas.

b) trocas gasosas, transporte de substâncias orgânicas, transporte de água e de sais minerais e trocas gasosas.

c) trocas gasosas, transporte de substâncias orgânicas, transporte de água e de sais minerais e transporte de sais.

d) absorção de luz, transporte de água, transporte de sais minerais e trocas gasosas.

e) absorção de compostos orgânicos, transporte de água e de sais minerais, transporte de substâncias orgânicas e trocas gasosas.

30. (UEL) As figuras a seguir mostram a morfologia interna de um grão de feijão e de um grão de milho.

30

As estruturas utilizadas para dividir as angiospermas em seus dois grandes grupos estão indicadas pelos números:

a) I e VI.

b) I e VII.

c) II e IV.

d) II e VI.

e) III e V.

gab

 

Publicado por: Djalma Santos | 11 de maio de 2017

TESTES DE CITOLOGIA (12)

01. (UFMG) Com base no esquema abaixo, que representa a ultraestrutura de uma célula de metáfita e suas relações intercelulares, assinale a(s) alternativa(s) correta(s):

01

I  II

0 0 – 8 é uma estrutura que permite a intercomunicação do citoplasma de células adjacentes.

1  1 – 3 e 6 são organoides em que há DNA e produção de moléculas de ATP.

2  2 – 3 e 5 são estruturas dotadas de membrana única.

3  3 – 7 é uma estrutura que possui membrana única.

4  4 – 5 pode ocorrer também em células de metazoários e protista.

02. (UFF) O acúmulo de metais pesados no solo, como o cádmio, o zinco e o chumbo, resultante de atividades industriais, tem grande impacto na biota desses locais. Apesar de serem requeridos em pequenas quantidades pelos organismos vivos, o excesso desses metais é tóxico para a maioria das espécies e compromete sua sobrevivência. Algumas espécies de plantas são capazes de crescer em solos que contêm grandes quantidades desses metais. Nas células dessas plantas podem ser encontrados diferentes mecanismos para a resistência a esses metais, como a imobilização por polissacarídeos, a exemplo da pectina, e a formação de complexos com ácidos orgânicos no interior da organela que ocupa o maior volume da célula desenvolvida. Os locais na célula vegetal onde ocorrem os mecanismos citados são, respectivamente:

a) membrana plasmática e cloroplasto.

b) parede celular e vacúolo.

c) microtúbulo e lisossomo.

d) parede celular e ribossomo.

e) membrana plasmática e vacúolo.

03. (PUC-SP) No interior de um blastômero, moléculas de DNA polimerase produzidas no retículo endoplasmático rugoso migraram para o núcleo, onde tiveram papel importante na duplicação dos cromossomos, o que levou a célula a se dividir. O trecho acima faz referências aos processos de síntese de:

a) proteínas, síntese de DNA e mitose em uma célula embrionária.

b) proteínas, síntese de DNA e mitose em uma célula somática.

c) proteínas, síntese de DNA e meiose em uma célula germinativa.

d) lipídios, síntese de RNA e mitose em uma célula embrionária.

e) lipídios, síntese de RNA e meiose em uma célula germinativa.

04. (UCS) Considerando que em cavalos o número diploide de cromossomos é de 64, pergunta-se: (I) Qual o número de autossomos em um espermatozoide de um macho? (II) Qual a constituição cromossômica do macho e da fêmea? Assinale a alternativa que contém a resposta correta.

a) (I) 32 autossomos; (II) macho 32 A + XY e fêmea 32 A + XX.

b) (I) 32 autossomos; (II) macho 62 A + XY e fêmea 62 A + XX

c) I) 31 autossomos; (II) macho 31 A + XY e fêmea 31 A + XX.

d) (I) 31 autossomos; (II) macho 62 A + XY e fêmea 62 A + XX.

e) I) 30 autossomos; (II) macho 30 A + XY e fêmea 30 A + XX.

05. (UEL) Analise a figura a seguir e responda.

05

Com base na figura e nos conhecimentos sobre o tema, analise as afirmativas a seguir:

I. Os cromoplastos contêm pigmentos carotenoides e podem ter função na atração de insetos e outros animais essenciais para a polinização cruzada e dispersão de frutos e sementes.

II. A parede celular determina a estrutura da célula, a textura dos tecidos vegetais e muitas características importantes, que permitem reconhecer as plantas como organismos. Todas as células vegetais têm uma parede primária e muitas têm uma parede secundária.

III. As paredes primárias contêm hemicelulose, as aparentemente não possuem pectinas e glicoproteínas. A lignina pode também estar presente nas paredes secundárias, mas é especialmente característica de células com parede primária e tem por função conferir resistência e rigidez à parede.

IV. Devido à presença de pectinas, as paredes secundárias são muito hidratadas, tornando-se mais plásticas. As células ativamente em divisão ou em alongamentos geralmente têm somente paredes secundárias.

Assinale a alternativa que contém todas as afirmativas corretas.

a) I e III.

b) II e IV.

c) I e II.

d) I, III e IV.

e) II, III e IV.

06. (UFLA) Os cromossomos estão divididos em dois braços cromossômicos pelo centrômero, sendo o tamanho desses braços utilizado como critério para classificá-los. Quando o centrômero se localiza perto de uma das extremidades e um dos braços é bem maior do que o outro, o cromossomo é classificado como:

a) telocêntrico.

b) acrocêntrico.

c) metacêntrico.

d) submetacêntrico.

07. (UFGD) As células são consideradas as unidades fundamentais que constituem todos os seres vivos, excetuando os vírus. Na sequência a seguir, são apresentadas funções específicas desempenhadas por estruturas das células.

I. Organela celular constituída de membrana externa, membrana interna (conhecida como crista) e material de preenchimento chamado matriz. Nela ocorre o processo de respiração celular e, por isso, é considerada a “casa de força” das células animais e vegetais.

II. Presente em células animais e em algumas células vegetais atuam na formação de cílios e flagelos e participam do processo de divisão celular.

III. É formada por um mosaico fluido de lipídios (glicolipídios) e proteínas. É responsável por manter a identidade química e a permeabilidade seletiva (controle constante de substâncias que entram e saem) das células bacterianas, animais e vegetais.

IV. Local em que estão armazenadas todas as informações sobre a função e estrutura das células bacterianas, animais e vegetais, possibilitando que se dividam e se repliquem, transmitindo às células filhas as informações existentes na célula progenitora.

V. Presentes em células bacterianas, animais e vegetais, encontram-se dispersos no citoplasma ou associados ao Retículo Endoplasmático e tem como função a síntese de proteínas.

Assinale a alternativa que contempla, pela ordem, a sequência de organelas correspondentes às afirmações.

a) Mitocôndria, centríolo, membrana plasmática, cromossomo e ribossomo.

b) Mitocôndria, cromossomo, membrana plasmática, ribossomo e centríolo.

c) Ribossomo, cromossomo, centríolo, membrana plasmática e mitocôndria.

d) Mitocôndria, ribossomo, centríolo, cromossomos e membrana plasmática.

e) Mitocôndria, centríolo, cromossomo, membrana plasmática e ribossomo.

08. (UEG) O exame dos cromossomos ao microscópio permite a visualização de regiões que se coram mais intensamente, denominadas de heterocromatina e de outras regiões que se coram com menor intensidade, chamadas eucromatina. As imagens a seguir ilustram o núcleo interfásico (A) e a cromatina sob as formas de heterocromatina e eucromatina (B).

08

A eucromatina e a heterocromatina na biologia celular possuem caracterizações e funcionalidades, tais como:

a) a eucromatina corresponde às regiões mais transcritas do genoma e, portanto, geneticamente mais ativas.

b) o grau de condensação da cromatina é diretamente proporcional à atividade de leitura da sequência de DNA.

c) o nucléolo é uma parte do genoma nuclear rico em heterocromatina e pobre em moléculas de histonas.

d) a heterocromatina se torna constitutiva quando é potencialmente constituída por genes do citoesqueleto.

e) todas as células de um organismo apresentam idênticas regiões de eucromatina e de heterocromatina.

09. (UPE) Leia o texto a seguir:

Nos últimos anos, vem crescendo a compreensão de que a membrana, de aspecto frágil ao microscópio, desempenha funções bem mais complexas que a de somente separar o conteúdo interno do meio externo das células. Uma origem embrionária comum pode explicar o fato de a membrana dos macrófagos e a das micróglias compartilharem as mesmas propriedades elásticas. Ambas as células são provenientes da mesoderme; além disso, têm de suportar forças intensas e grande deformação da superfície durante a fagocitose, o que justifica membranas mais resistentes. Assim, as propriedades elásticas da membrana conservam uma relação direta com a função da célula no organismo.

Fonte: http://revistapesquisa.fapesp.br/2013/11/18/fronteiras-fluidas/ (Adaptado)

Sobre isso, é correto afirmar que:

a) a fagocitose nos mecanismos de defesa do corpo é muito importante e só é possível por causa da parede celular que facilita a alteração da forma, por mudar de acordo com o ambiente e o estado em que a célula se encontra, influenciando seu desempenho.

b) a mesoderme é uma das duas camadas de células que formam o embrião em seus estágios iniciais e da qual todas as células dos sistemas sanguíneo e nervoso central se originam. Assim, a origem comum favorece a migração de macrófagos e micróglia para a mesma região do corpo, durante o desenvolvimento.

c) de modo semelhante à micróglia, os macrófagos também habitam o sistema nervoso central e realizam fagocitose, emitindo prolongamentos que identificam, englobam e destroem tanto células velhas como agentes infecciosos e partículas estranhas ao organismo.

d) micróglia é a principal célula de defesa do sistema nervoso central. Ela sonda o ambiente à procura de células doentes e agentes infecciosos. Quando os encontra, emite prolongamentos e os engloba por fagocitose com o auxílio da rede de actina do citoesqueleto.

e) o que determina, em grande parte, a plasticidade da membrana é o retículo endoplasmático, uma rede difusa de filamentos da proteína queratina que se distribui pelo interior da célula e se ancora nos lipídeos da membrana.

10. (UFMS) Um estudo publicado na revista americana Science sugere que certas bactérias intestinais surgiram há pelo menos 15 milhões de anos, muito antes dos seres humanos. Assinale a alternativa incorreta em relação às bactérias.

a) A célula das bactérias não apresenta organelas membranosas citoplasmáticas.

b) A célula bacteriana apresenta membrana plasmática que delimita o citoplasma.

c) Além de DNA cromossômico, a célula bacteriana pode conter o DNA denominado plasmídeo.

d) A molécula de DNA circular que constitui o cromossomo bacteriano é envolta por uma membrana formando um pequeno núcleo, chamado nucleoide.

e) No interior da célula de certas bactérias são produzidos e secretados polissacarídeos, proteínas ou ambos, que se agregam a região externa da parede celular formando a cápsula bacteriana.

11. (UNICENTRO) Os esquemas destacados representam dois organismos.

11

A partir dos conhecimentos sobre os organismos representados, pode ser afirmado que ambos:

a) apresentam braços de dineína.

b) são desprovidos de corpúsculos basais.

c) não possuem mitocôndrias.

d) apresentam o mesmo tipo de motilidade.

12. (UNICENTRO) O reino Monera abriga todos os seres vivos unicelulares, que não possuem um núcleo definido e têm uma parede celular rígida. Isso quer dizer que o material genético desses seres fica disperso no interior da célula. As bactérias e “cianofíceas” — ou cianobactérias, como são chamadas na nomenclatura moderna —, são os habitantes desse reino. As bactérias, formas de vida de tamanho microscópico, interferem não apenas na vida humana, mas em toda a ecologia da Terra. Quando nosso planeta esfriou, há, pelo menos, 4,6 bilhões de anos, as primeiras formas de vida que apareceram foram as bacterianas. Segundo o professor de paleontologia da Universidade de São Paulo (USP), Luis Eduardo Anelli, existem evidências seguras de que as mais antigas formas de vida são fósseis de bactérias com 3,5 bilhões de anos.

(BACTERIAS…, 2016).

A respeito do reino comentado no texto, é possível afirmar:

a) apresenta uma grande diversidade metabólica.

b) o material genético disperso no citosol é associado a histonas.

c) seus representantes podem ser encontrados em todos os níveis tróficos de uma cadeia alimentar como exceção do primeiro.

d) o primeiro ser vivo desse reino que habitou a Terra era fotoautótrofo.

e) possui um citoplasma compartimentado e com endomembranas.

13. (UPF) Considere o cariótipo humano apresentado na figura abaixo. Assinale a única alternativa que contém informações corretas sobre ele.

13

a) Refere-se a um indivíduo triploide, do sexo feminino.

b) Pertence a um portador de uma trissomia, a qual ocorre apenas em indivíduos do sexo feminino.

c) Apresenta um caso de alteração cromossômica numérica classificada como euploidia.

d) Pertence a um portador de trissomia autossômica, causada por erro na segregação cromossômica durante a meiose.

e) Refere-se a um indivíduo haploide, devido à ausência do cromossomo Y.

14. (UEM) Considere a situação na qual um organismo unicelular consumidor aeróbio fagocita uma bactéria autotrófica, e assinale a(s) alternativa(s) correta(s).

01. O enunciado descreve como consumidor um protozoário, portador de citoesqueleto e mitocôndrias.

02. Para a digestão da bactéria fagocitada, o consumidor produz enzimas digestivas em seu retículo endoplasmático. Estas são conduzidas ao complexo golgiense, onde são modificadas e empacotadas em vesículas, os lisossomos primários.

04. Apesar de possuírem células estruturalmente diferentes e de pertencerem a Reinos diferentes, ambos os organismos citados no enunciado geral da questão possuem a mesma lógica química de composição estrutural, de armazenamento e de transmissão da informação hereditária.

08. Conforme o enunciado geral da questão, a célula procariótica será degradada pela ação de hidrolases dos lisossomos da célula eucariótica.

16. A bactéria autotrófica possui cloroplastos, que lhe permitem realizar o processo de fotossíntese, sendo, por isso, denominada de autotrófica.

Soma das alternativas corretas:

15. (UDESC) Após assistir a diferentes modalidades desportivas na Olimpíada do Rio 2016, um jovem resolve abandonar sua vida sedentária e se propõe iniciar a prática de exercícios físicos intensos e regulares. Analise as proposições em relação às células musculares esqueléticas deste jovem.

I. O número de mitocôndrias nestas células deve aumentar com o passar do tempo.

II. O número de mitocôndrias aumentará indefinidamente à medida que os exercícios físicos forem aumentando gradativamente.

III. O nível do consumo de oxigênio nestas células deve aumentar com o passar do tempo.

IV. O número de mitocôndrias não se alterará nestas células.

V. O único aumento notável nestas células será a produção de ATP.

Assinale a alternativa correta:

a) Somente as afirmativas II e III são verdadeiras.

b) Somente as afirmativas III e IV são verdadeiras.

c) Somente as afirmativas I e III são verdadeiras.

d) Somente as afirmativas III, IV e V são verdadeiras.

e) Somente as afirmativas IV e V são verdadeiras.

16. (UPF) Analise a figura e assinale a alternativa que indica o que é representado nela.

16

a) O surgimento das células procariotas.

b) A teoria celular.

c) A teoria da endossimbiose.

d) A teoria da abiogênese.

e) A origem da vida.

17. (ACAFE) Em 1665, Robert Hooke, ao examinar cortes de cortiça em seu microscópio, observou espaços que denominou de célula. A Ciência que estuda as células, sua composição e estruturas é denominada Citologia. Nesse sentido, a alternativa correta é:

a) a respiração celular é um processo em que moléculas orgânicas são oxidadas e ocorre a produção de ATP – adenosina trifosfato, que é usada pelos seres vivos para suprir suas necessidades energéticas. A respiração celular ocorre em três etapas básicas: a glicólise, o ciclo de Krebs e a fosforilação Essas etapas ocorrem em uma organela celular denominada mitocôndria.

b) a silicose é uma doença muito comum em trabalhadores que lidam com amianto. Um dos componentes do amianto é a sílica, uma substância inorgânica que forma minúsculos cristais que podem se acumular nos pulmões. As células dos alvéolos pulmonares afetadas por esses cristais acabam sofrendo autólise, devido à destruição das mitocôndrias.

c) os fibroblastos são um tipo de célula do tecido conjuntivo. Eles sintetizam e secretam glicoproteínas, como o colágeno. As organelas citoplasmáticas denominadas retículo endoplasmático agranular e complexo golgiense participam de forma interativa para a produção e a secreção dessa glicoproteína.

d) o citoplasma de células eucarióticas apresenta um conjunto de fibras finas e longas, de constituição proteica, chamado de citoesqueleto. Entre as funções desempenhadas pelo citoesqueleto podemos citar a compartimentalização do citoplasma, a realização de movimentos celulares e o deslocamento de determinadas organelas citoplasmáticas.

18. (UFLA) Certas substâncias podem entrar e sair das células transportadas por bolsas membranosas. Esses transportes são chamados de endocitose e exocitose, respectivamente. Os processos de endocitose são denominados como fagocitose e pinocitose. Marque a alternativa correta.

a) Pinocitose é um processo de englobamento de líquidos e de pequenas partículas que ocorre em diversos tipos celulares.

b) Na endocitose, o material englobado, muitas vezes, se une ao lisossoma para ser digerido, sendo esse processo chamado de autofagia.

c) Na fagocitose, a célula emite pseudópodes que envolvem a partícula a ser englobada, formando uma vesícula que recebe o nome de autofagossoma.

d) A maioria das células humanas engloba, por fagocitose, partículas de LDL para aproveitar o colesterol como matéria-prima para produção de membranas lipoproteicas.

19. (UFAM) Analise as afirmativas a seguir:

I. Cloroplastos são estruturas celulares componentes do sistema de endomembranas, assim como o retículo endoplasmático.

II. Estereocílios são especializações das membranas plasmáticas que permitem o aumento de área superficial.

III. As proteínas motoras são componentes do citoesqueleto celular.

IV. Os microfilamentos participam ativamente da citocinese.

V. Os centríolos participam da síntese proteica, facilitando a ligação RNA transportador-códon.

Assinale a alternativa correta:

a) Somente as afirmativas I e IV estão corretas.

b) Somente as afirmativas I, II e V estão corretas.

c) Somente as afirmativas II, III e IV estão corretas.

d) Somente as afirmativas II, III, IV e V estão corretas.

e) Todas as afirmativas estão corretas.

20. (UFAM) Analise as seguintes alternativas e assinale a incorreta:

a) todos os organismos eucariontes vivos dependem das mitocôndrias para a sua “produção” de energia.

b) os peroxissomos quebram cadeias longas de ácidos graxos.

c) os lisossomos são produzidos no Complexo de Golgi.

d) os hepatócitos de uma pessoa alcoólatra devem apresentar um retículo endoplasmático liso expandido.

e) a água, em condições fisiológicas, depende de canal hidrofílico para sua passagem através da bicamada lipídica das membranas.

gabreal

 

Older Posts »

Categorias