Publicado por: Djalma Santos | 15 de novembro de 2010

CÓDIGO GENÉTICO

As células, ao se duplicarem, transmitem às descendentes suas características. Essa transmissão, bem como uma série de outras funções celulares, são realizadas através do código genético. Os símbolos desse código natural são, em sua essência, as quatro “bases nitrogenadas” que compõem a molécula do DNA, designadas por A (adenina), G (guanina), C (citosina) e T (timina). As mensagens, por seu turno, têm por finalidade sintetizar proteínas que vão exercer determinadas funções na célula. Sendo vinte o número dos aminoácidos que, em posições e proporções diferentes, entram na constituição das diversas proteínas e apenas quatro o número de bases do DNA (A, G, C e T) e do RNA (A, G, C e U), o código não pode ser unitário, tampouco binário. Se unitário (41 = 4), apenas quatro aminoácidos diferentes poderiam ser codificados. Se binário (42 = 16), apenas dezesseis diferentes aminoácidos seriam codificados. Em ambos os casos, o número seria insuficiente, para codificar os vinte diferentes aminoácidos. Os “vocábulos” do código genético, portanto, devem conter mais de duas “letras”. Arranjando-se com repetição, as quatro bases, três a três (43 = 64), têm-se sessenta e quatro “vocábulos” ou códons (unidades do código genético), número mais que suficiente para codificar os 20 diferentes aminoácidos participantes das diversas proteínas. Essas considerações matemáticas foram as primeiras a sugerir que a unidade de codificação era formada por três nucleotídeos. Uma série de estudos, que procederam a essas considerações, veio ratificar os tripletos (ternos), bem como demonstrar várias outras propriedades do código genético, que estudaremos mais adiante.

DECIFRAÇÃO DO CÓDIGO GENÉTICO

A decifração do código genético teve seu passo inicial dado por volta de 1957, quando Ochoa e Heppel isolaram e purificaram a polinucleotídeo-fosforilase. Essa enzima catalisa, “in vitro”, a síntese de RNA, sem a necessidade da presença de DNA ou RNA como molde, podendo, inclusive, sintetizar RNA com apenas um tipo de nucleotídeo, tais como poli-U (homopolímero formado apenas por uracil) e poli-A (homopolímero constituído apenas por adenina). Com base nesses e em outros elementos, Niremberg e Matthaei, por volta de 1961, estabeleceram o primeiro método para decifrar o código genético. Adicionando poli-U (RNAm artificial que contém uracil, como única base) a extrato de Escherichia coli, isento de DNA e RNA, e mais uma mistura dos vinte diferentes aminoácidos, notaram que só a fenilalanina era incorporada a essa cadeia proteica sintetizada “in vitro”, formando uma “poli-fenilalanina” (polipeptídeo constituído apenas por fenilalania), como mostra a figura a seguir. Esse primeiro resultado levou os referidos pesquisadores a concluir que o códon para o aminoácido fenilalanina era três uracilas (UUU). Isso corresponde à seguinte mensagem: “acrescente-se uma fenilalanina à proteína em formação”.

Usando-se RNAs sintéticos mais complexos (heteropolímeros) e técnicas mais sofisticadas, foi possível decifrar todo o código genético. No quadro abaixo está representado o código genético-padrão. Percebemos que todos os 64 ternos possuem um significado apesar de haver apenas 20 aminoácidos. Lembramos que os códons, mostrados no referido quadro, dizem respeito ao RNA mensageiro e são complementares aos códons do DNA correspondente.

ALGUMAS CONSIDERAÇÕES IMPORTANTES ACERCA DO CÓDIGO GENÉTICO

I. Códons: sequência de três nucleotídeos adjacentes, no DNA ou no RNAm, que, com exceção de três deles (UAA, UAG e UGA, no código-padrão), codifica um aminoácido específico.

II. Ausência de superposição de códons: uma dada base pertence a uma só trinca ou códon.

III. O código genético é contínuo: não há espaçamento entre os códons.

IV. Códons de iniciação: o início da síntese de um polipeptídeo é assinalado, via de regra, pela presença, no RNA mensageiro, do códon AUG. Pelo fato de essa trinca codificar a metionina, a maioria dos polipeptídeos recém-sintetizados possui esse aminoácido no terminal amino, embora ele possa ser removido, subsequentemente, por processamento pós-transducional da proteína. Sendo o AUG o único códon para a metionina, como mostra o quadro acima e a tabela abaixo, AUGs que não são de iniciação podem ocorrer na região interior do transcrito. Em procariotos além do AUG é usado, também, GUG, que codifica valina. Nas bactérias, o sinal AUG é precedido por uma sequência curta de quatro a nove nucleotídeos, denominada sequência de Shine-Dalgarno ou caixa Shine-Dalgarno (figura abaixo), em homenagem aos pesquisadores australianos John Shine e Lynn Dalgarno, que a identificaram no RNAm. Essa sequência consenso, presente apenas em procariotos e que não é traduzida, atua como zona de reconhecimento e de ligação à extremidade 3’ do RNAr 16S presente na subunidade ribossômica menor (30S).

V. Códons de terminação (códons de pontuação): três trincas (UAA, UAG e UGA, no código-padrão) não codificam nenhum aminoácido e têm como função sinalizar a conclusão da síntese proteica. Quando presentes no meio de um heteropolímero interrompem, prematuramente, a síntese proteica, resultando em polipeptídeos menores que o esperado. Essas trincas, indicadas no quadro anterior pela palavra “fim”, são denominadas códons de terminação ou finalização e uma delas sempre ocorre no final de um transcrito, no ponto onde a tradução deve parar.

VI. Degeneração do código genético (o código genético é redundante): todos os aminoácidos, exceto a metionina e o triptofano (ver quadro acima e tabela a seguir), possuem mais de um códon.

Lembramos que apenas a metionina e o triptofano (destacados na tabela acima), que são os aminoácidos menos comuns das proteínas em geral, possuem códons únicos, AUG e UGG, respectivamente. Todos os outros possuem dois ou mais códons, condição que levou a se dizer que existe uma degeneração no código genético. Há casos, inclusive, como a arginina, a leucina e a serina que chegam a ser especificados por seis códons diferentes.

A diferença entre os códons, em se tratando de aminoácidos que possuem múltiplos códons está, usualmente, na terceira base (extremidade 3′ ), como se pode observar no quadro do tópico “decifração do código genético” acima. Este fato pode ser constatado tomando como exemplo a alanina que é codificada pelos ternos GCU, GCC, GCA e GCG. Outro exemplo é a glicina, codificada por GGA, GGU, GGG e GGC. Dessa forma, as duas primeiras letras de cada códon são, em última análise, os determinantes primários da especificidade.

VII. O código genético não é universal: quando o código genético foi completado em 1966, supunha-se que ele era universal. Trabalhos desenvolvidos em 1979 constataram, inicialmente, que os genes (trechos da molécula de DNA, dotados de informações biológicas) da mitocôndria humana utilizam um código genético ligeiramente diferente. Nesses genes, UGA, que normalmente é um códon de terminação, codifica triptofano; AGA e AGG (normalmente arginina) são códons de terminação e AUA e AUU (normalmente isoleucina) codifica a metionina. Essas alterações foram, posteriormente, confirmadas no genoma mitocondrial de outros mamíferos. Códigos fora do padrão e ligeiramente diferentes foram descobertos, também, nas mitocôndrias de Drosophila, de leveduras, de Neurospora e de vegetais. CUU, CUC, CUA e CUG, que codificam normalmente a leucina correspondem a treonina nas mitocôndrias de leveduras. CGG, códon que corresponde normalmente a arginina, codifica o triptofano em mitocôndrias de células vegetais. Corroborando com a ideia da não universalidade do código genético, estudos recentes mostraram que códigos incomuns não estão restritos às mitocôndrias. Foi constatado que códons não padrão, parecem ser comuns entre os protozoários, incluindo Tetrahymena e Paramecium, nos quais, os códons finalizadores UAA e UAG, especificam glutamina. Exemplos de códons não padrão são mostrados no quadro abaixo.

VIII. O código genético não é ambíguo: nenhum códon especifica mais de um aminoácido.

FIXANDO

01. (FUVEST) A seguir está representada a sequência dos 13 primeiros pares de nucleotídeos da região codificadora de um gene.

— A T G A G T T G G C C T G —

— T A C T C A A C C G G A C —

A primeira trinca de pares de bases nitrogenadas à esquerda corresponde ao aminoácido metionina. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.

CÓDON DO RNAm AMINOÁCIDOS
ACC Treonina
AGU Serina
AUG Metionina
CCU Prolina
CUG Leucina
GAC Ácido aspártico
GGC Glicina
UCA Serina
UGG Triptofano
CCG Prolina

Com base no exposto e em seus conhecimentos sobre o assunto, assinale a(s) alternativa(s) correta(s).

I    II

0  0 – A sequência de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA será - AUG AGU UGG CCU G -.

1  1 -  Utilizando a tabela do código genético fornecida, a sequência dos três primeiros aminoácidos seguintes à metionina, no polipeptídio codificado por esse gene será - Serina – triptofano – Prolina -.

2   2 – A sequência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotídeos (deleção do par de bases A = T) será  - Metionina – Serina – Glicina -.

3   3 – A sequência de bases nitrogenadas do RNA mensageiro, transcrito a partir do segmento do DNA mutante mencionado na alternativa anterior, será - UAC UCA CCG GAC -.

4   4 – A sequência dos três últimos aminoácidos de um polipeptídio codificado por um alelo mutante desse gene, originado pela perda do décimo segundo par de nucleotídeos (deleção do par de bases A = T), será  – Serina – Triptofano – Glicina -.

02. (UFAL) Observe o quadro abaixo, que mostra alguns aminoácidos codificados pelos códons de RNAm (RNA mensageiro) humano. Sobre este assunto, em correto afirmar:

Metionina AUG
Serina UCU, UCC, UCA, UCG, AGU, AGC
Triptofano UGG
Tirosina UAU, UAC
Isoleucina AUU, AUC, AUA

a) o código genético é chamado de “universal”, pois vários códons podem codificar o mesmo aminoácido.

b) a iniciação da síntese proteica sempre ocorre com a incorporação de metionina ou tirosina na cadeia polipeptídica.

c) o código genético é dito redundante, porque tem o mesmo significado em praticamente todos os organismos.

d) a substituição da segunda base nitrogenada por citosina, no códon do triptofano, pode provocar a incorporação de outro aminoácido num polipeptídeo em formação.

e) uma mutação substitutiva de guanina por citosina no códon da metionina, não produziria interferência na síntese proteica.

03. (PUC-PR) Os códons AGA, CUG e ACU do RNA mensageiro codificam, respectivamente, os aminoácidos arginina, leucina e treonina. A sequência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a sequência de nucleotídeos GAC TGA TCT será, respectivamente:

a) arginina, leucina, treonina.

b) leucina, arginina, treonina.

c) leucina, treonina, arginina.

d) treonina, leucina, arginina.

e) treonina, arginina, leucina.

04. (CEFET-S. Paulo)

QUADRO DE CÓDONS DO RNAm
CÓDONS AMINOÁCIDOS
UUU, UUC Fenilalanina
GUU, GUC, GUA, GUG Valina
GCU, GCC, GCA, GCG Alanina
GAU, GAC Ácido aspártico
UAU, UAC Tirosina
ACU, ACC, ACA, ACG Treonina
CUU, CUC, CUA, CUG Leucina

O quadro acima mostra que:

a) Caso ocorra a substituição da primeira base nitrogenada G do aminoácido valina pela base nitrogenada C, será codificado o aminoácido leucina.

b) Uma trinca codifica mais de um aminoácido.

c) Um mesmo aminoácido só pode ser codificado por uma única trinca.

d) Qualquer mutação que ocorrer na última base nitrogenada do códon que codifica o aminoácido valina, ele não será sintetizado.

e) A sequência de trincas do DNA que origina o aminoácido ácido aspártico é CUA ou CUG.

05. (PUC-RIO) Quanto ao código genético, é correto afirmar que:

a) as proteínas são transcritas a partir do RNA, que é traduzido a partir do DNA.

b) tanto o DNA quanto o RNA das células eucariotas são moléculas de fita dupla.

c) o RNA é transcrito a partir do DNA e é responsável pela tradução proteica.

d) as proteínas são traduzidas diretamente pelo DNA, que é transcrito pelo RNA.

e) o DNA é traduzido em proteínas diretamente nos ribossomos.

06. (UNICAMP) Uma molécula de DNA sintetizada artificialmente, com a sequência TATCCGCCCTACCCG, foi utilizada para sintetizar a seguinte sequência de cinco aminoácidos (AA) representados por símbolos:

A mesma molécula de DNA foi submetida a tratamento com substância mutagênica, provocando alteração na 12a base da sequência, que passou a ser uma timina. Com base no exposto, assinale a(s) alternativa(s) correta(s).

I   II

0  0 – O aminoácido AA4 será substituído por um aminoácido AA2.

1  1 – O aminoácido AA4 será substituído por um aminoácido AA3.

2  2 – O aminoácido AA4 será substituído por um aminoácido AA1.

3  3 – Em face  da existência de  códons  sem  sentido,  haverá uma  terminação prematura da cadeia proteica.

4  4 – Em face de o código genético ser degenerado, não haverá alteração na cadeia proteica.

07. (CEFET-MG) Apesar da maioria dos aminoácidos ter pelo menos dois códons no RNAm, a metionina e o triptofano possuem apenas um códon AUG e UGG, respectivamente. Referindo-se a esses dados, é correto afirmar que

a) o anticódon para o triptofano é ACC.

b) o códon para o triptofano apresenta adenina.

c) a trinca no DNA para a metionina pode ser UAC.

d) o anticódon para a metionina apresenta duas bases púricas.

08. (UEL) Com relação ao código genético, é incorreto afirmar que:

a) Cada aminoácido, na proteína sintetizada, é codificado por uma trinca de bases de uma cadeia de DNA.

b) Cada RNA transportador possui, em determinada região de sua molécula, uma trinca de bases denominada códon.

c) O suporte para a síntese de proteínas é dado pelos ribossomos, que são constituídos por RNA ribossômico e proteínas.

d) O DNA não participa diretamente da síntese de proteínas, sendo o RNA mensageiro a molécula que contém as informações.

e) O RNA transportador, unido a um aminoácido específico, acopla-se aos ribossomos de acordo com as trincas do RNA mensageiro.

09. (UFOP) O quadro abaixo mostra o código genético e os aminoácidos por ele codificados.

Fen = Fenilalanina.  Leu = Leucina.         Ile = Isoleucina.                 Met = Metionina.

Val = Valina.                  Ser = Serina.               Pro = Prolina.                        Tre = Treonina.

Ala = Alanina.               Tir = Tirosina.          His = Histidina.                    Gln = Glutamina.

Asn = Asparagina.      Lis = Lisina.                Asp = Ácido aspártico.     Glu = Ácido glutâmico.

Cis = Cisteína.               Trp = Triptofano.   Arg = Arginina.                      Gli = Glicina.

Com base no quadro e em seus conhecimentos sobre síntese de proteínas, considere um segmento de DNA que possui a seguinte sequência de bases:

ACGCGTAAGTTTGTG

É correto afirmar:

a) A sequência de aminoácidos codificada por esse segmento será: treonina-arginina-lisina-fenilalanina-valina.

b) A sequência de aminoácidos codificada por esse segmento será: cisteina-alanina-fenilalanina-lisina-histidina.

c) Se um nucleotídeo for substituído por outro em um segmento que codifica determinada proteína, a situação poderá ser mais drástica, caso um nucleotídeo seja suprimido.

d) A sequência de bases do RNA-mensageiro será UGCGCATTCAAACAC.

10. (UFScar) Diz-se que o código genético é “degenerado” porque:

a) existe mais de um aminoácido para cada códon.

b) se desorganiza na velhice.

c) mais de um códon pode codificar um mesmo aminoácido.

d) existem códons que não codificam qualquer aminoácido.

e) o código é diferente no DNA e no RNA.

11. (PUC-RIO) Diversas doenças estão relacionadas a mutações no material genético. Porém, mutações pontuais, com a alteração de apenas uma base nitrogenada, muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. Isto se dá devido ao fato de:

a) o código genético ser universal.

b) o código genético ser repetitivo ou degenerado.

c) o erro ser corrigido pela célula durante a tradução.

d) o código genético não poder sofrer alterações.

e) os genes mutados não serem transcritos ou traduzidos.

12. (FUVEST) O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons). A sequência de códons do RNA mensageiro determina a sequência de aminoácidos da proteína. É correto afirmar que o código genético

a) varia entre os tecidos do corpo de um indivíduo.

b) é o mesmo em todas as células de um indivíduo, mas varia de indivíduo para indivíduo.

c) é o mesmo nos indivíduos de uma mesma espécie, mas varia de espécie para espécie.

d) permite distinguir procariotos de eucariotos.

e) é praticamente o mesmo em todas as formas de vida.

13. (UERJ) A mutação em um gene, por consequência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptídeo e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são:

5′ AUGUGGUUUGCACACAAAUGAUAA 3′ (normal)

5′ AUGUGGUUUGAACACAAAUGAUAA 3′ (alterada)

A tabela a seguir identifica alguns códons.

AMINOÁCIDO CÓDON
Alanina GCC, GCG, GCU, GCA
Ácido aspártico GAC, GAU
Cisteína UGC, UGU
Glicina GGA, GGC, GGG, GGU
Ácido glutâmico GAA, GAG
Fenilalanina UUC, UUU
Metionina AUG
Triptofano UGG
Treonina ACA, ACC, ACG, ACU
Lisina AAA, AAG

Observe que:

- o códon da metionina é também o do início da tradução.

- os códons de término da tradução são UAA, UAG e UGA.

O aminoácido encontrado no peptídeo normal e aquele que o substituiu no peptídeo mutante são, respectivamente:

a) lisina e cisteína.

b) treonina e triptofano.

c) alanina e ácido glutâmico.

d) fenilalanina e ácido aspártico.

14. (FCMSC) Um botânico, após uso de radiação, obteve uma variedade de planta que diferia da selvagem por apresentar flores pretas. Um bioquímico constatou que tal pigmento fora produto de uma reação química catalisada por uma enzima nova, com 3 ácidos aminados terminais a menos que o relacionado com a síntese do pigmento selvagem. Um geneticista molecular, consultado a respeito, concluiu que a radiação tinha eliminado, nessa variedade, pelos menos:

a) 3 genes.

b) 3 pares de genes.

c) 3 pares de nucleotídeos do DNA.

d) 3 pares de nucleotídeos do RNA mensageiro.

e) 9 pares de nucleotídeos do DNA.

15. (UFU) O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídeos do DNA (AAT, GAA e outras). Assim sendo, podemos dizer que

I. O código genético é degenerado, o que significa que um aminoácido pode ser codificado por mais de uma trinca.

II. Um aminoácido pode ser codificado por apenas uma trinca de nucleotídeos de DNA.

III. Assim como a leucina pode ser codificada por diferentes trincas, uma determinada trinca também pode codificar diferentes aminoácidos.

Estão corretas afirmativas:

a) apenas III.

b) apenas II.

c) apenas I.

d) I e III.

e) nenhuma delas.

16. (FUVEST) O código genético está todo decifrado, isto é, sabe-se quais trincas de bases no DNA correspondem a quais aminoácidos nas proteínas que se formarão.

SEQUÊNCIA DO DNA AMINOÁCIDO
AGA serina (SER)
CAA valina (VAL)
AAA fenilalanina (FEN)
CCG glicina (GLI)
AAT leucina (LEU)
GAA leucina (LEU)

Com base na tabela acima, assinale a(s) alternativa(s) correta(s).

I  II

0  0 – Se  um RNAm tem  sequência de trincas UUAUUUCUUGUUUCUGGC, a sequência dos aminoácidos no polipeptídeo correspondente será: LEU – FEN – LEU – VAL – SER – GLI.

1  1 – Os anticódons dos RNAt da leucina serão AAU e GAA.

2  2 – O anticódon do RNAt da glicina será GGC.

3  3 – O anticódon do RNAt da valina será CAA.

4  4 – O anticódon do RNAt da serina será UCU.

17. (MACK) Uma molécula de RNA mensageiro com 90 bases nitrogenadas apresenta:

a) 90 códons e 90 nucleotídeos.

b) 30 códons e 90 nucleotídeos.

c) 30 códons e 30 nucleotídeos.

d) 60 códons e 30 nucleotídeos.

e) 30 códons e 60 nucleotídeos.

18. (FUVEST) Considerando tabela a seguir, que indica sequências de bases do RNA mensageiro e os aminoácidos por elas codificados.

UUU  fenilalanina 

UUC

AAU  asparagina 

AAC

UUA  leucina 

UUG

AAA  lisina 

AAG

CCU  prolina 

CCC

CCA

CCG

GUU  valina 

GUC

GUA

GUG

Com base na tabela fornecida, e considerando um segmento hipotético de DNA, cuja sequência de bases é AAGTTTGGT, qual seria a sequência de aminoácidos codificada?

a) Asparagina, leucina, valina.

b) Asparagina, lisina, prolina.

c) Fenilalanina, lisina, prolina.

d) Fenilalanina, valina, lisina.

e) Valina, lisina, prolina.

19. (MACK) A respeito do código genético, é correto afirmar que:

a) é considerado degenerado, porque há códons diferentes para um mesmo aminoácido.

b) apresenta códons diferentes em cada espécie de ser vivo, o que explica a diversidade biologia.

c) é dado pela sequência de aminoácidos em uma proteína.

d) resulta em duas cópias idênticas, sem a possibilidade de erro no processo, sempre que é copiado.

e) todos os seus tipos de bases nitrogenadas podem ser encontrado tanto no DNA quanto no RNA.

20. (UPE) Uma cadeia de DNA apresenta a seguinte sucessão de nucleotídeos AAA TAC GTA GTA e a partir dela é sintetizado um polipeptídio.

CÓDONS AMINOÁCIDOS ABREVIAÇÃO DO AMINOÁCIDO
UUU, UUC Fenilalanina Phe
CAU, CAC Histidina His
AAA, AAG Lisina Lis
AUG Metionina Met
UAA, UUG Leucina Leu
UCC, UCA Serina Ser
GAA, GAG Ácido Glutâmico Glu

Assinale a alternativa que indica a sequência de aminoácidos do polipeptídeo sintetizado, utilizando o quadro abaixo:

a) Phe – His – His – Glu.

b) Glu – Leu – Ser – Ser.

c) His – His – Met – Phe.

d) Phe – Met – His – His.

e) Met – Phe – Lis – Lis.

GABARITO

01 02 03 04 05 06 07 08 09 10
VVVFF D C A C FFVFF A B B C
11 12 13 14 15 16 17 18 19 20
B E C E C VVFVF B C A D

About these ads

Responses

  1. Professor, são pouquíssimos os sites em que eu vejo os assuntos de biologia dados de maneira tão didática e ao mesmo tempo, aprofundados. Excelente seu blog!

    • Amigo João Pedro.
      Obrigado pelo comentário.
      Um forte abraço.
      Djalma Santos

  2. Professor Djalma Santos, eu posso dizer que o Código genético não é universal, pelo fato de outros organismos, com algumas bactérias, não apresentarem essa universalização.

    • Prezada Priscila
      Se você voltar a ler “CÓDIGO GENETICO”, matéria publicada neste blog no dia 15/11/2010, verá que no item “VII. O CÓDIGO GENÉTICO NÃO É UNIVERSAL” não há referência às bactérias. De qualquer forma, não devemos, literalmente, considerar um processo ou algo como universal se ele apresenta exceções. Em verdade, o código genético considerado padrão está muito disseminado, mas não é, a bem da verdade universal.
      Abraços
      Djalma Santos

  3. Por favor, em resolução da questão 15 procedeu-se (não só aqui neste site) a resposta como letra C, onde aparece “apenas I”. Gostaria de saber se não há algum erro, pois como o exemplo da metionina (met) e triptofano (tri), HÁ SIM AMINOÁCIDO QUE PODE SER CODIFICADO POR APENAS UMA TRINCA DE NUCLEOTÍDEOS DE DNA. Deve estar havendo um erro, por parte do vestibular em si, e consequentemente dos sites que copiaram ela. Grato

    • Caro Joel Júnior
      A expressão “Um aminoácido pode ser codificado por apenas uma trinca de nucleotídeos de DNA” (alternativa II) não é conclusiva, pois pode também não ser, como na quase totalidade dos casos. Observe que ela é bem diferente da expressão que você usou no comentário “Há sim aminoácido que pode ser codificado por apenas uma trinca de nucleotídeos de DNA”. Dessa forma, a alternativa II não deve ser considerada correta.
      Um abraço
      Djalma Santos

  4. Professor muito bom esse blog, achei tudo o que procurava, esta de parabéns.

    • Obrigado pelo comentário. “Use e abuse” do nosso blog.
      Sucesso
      Djalma Santos

  5. Tenho uma dúvida referente à questão 15 na seguinte afirmação:
    II. Um aminoácido pode ser codificado por apenas uma trinca de nucleotídeos de DNA
    Esta afirmação também não estaria correta uma vez que, o aminoacido metionina e triptofano são codificando apenas por uma trinca de nucleotídeos????

  6. desculpa, nao tinha visto que já haviam perguntado esta mesma pergunta!!!

    • Prezada Maria Beatriz
      Não tem problema. Isto é uma demonstração que você está estudando.
      Sucesso
      Djalma Santos

  7. isso me ajudou bastante nos meus estudos e gostei do blog, valeu pro

    • Siozimila
      Disponha do nosso blog.
      Sucesso
      Djalma Santos

  8. Professor, nao sei se ainda posta, mas peço, por favor, que nao pare, Encontrei seu blog agora e ja favoritei! Um excelente trabalho! Entrei aqui em busca da resposta sobre o código genético ser ou nao universal e achei o que queria, entretanto me ocorreu outra duvida, sou vestibulanda e geralmente aprendemos que o código genético é universal, mas sabemos que não, assim como o senhor citou acima, gostaria de saber se em uma questão objetiva eu posso assinalar a opção em que nega essa universalidade? Ou se esse seria um item incorreto, pois temos condicionado na mente que o código é universal, enfim, agradeço de coração o seu trabalho, tenho certeza que ajuda muita gente! Abraços

    • Prezada Rebeca
      Nosso blog continua em atividade. Espero continuar “alimentando-o” por muito tempo. Com relação a sua colocação sobre a universalidade do código genético, espero que as comissões dos diversos vestibulares não coloque esta questão diretamente. Se o fizer, faça-o com considerações prévias, tais como: considerando os seres superiores; não considerando estruturas celulares, etc.
      Um forte abraço
      Djalma Santos

  9. Obrigada pela resposta, professor Djalma Santos, ficarei atenta as possíveis considerações sobre o assunto. Fico muito feliz por saber que continuam em atividade! Abraços

    • Cara Rebeca
      “Use e abuse” do nosso blog.
      “Tudo o que chega, chega sempre por alguma razão.” (Fernando Pessoa)
      Sucesso no vestibular
      Djalma Santos

  10. Professor, qual a fonte que você utilizou para afirmar que o código não é universal ?

    • Caro Felipe
      - Um processo, como o código genético, que apresenta exceções, não pode, literalmente, ser considerado universal. Algumas dessas exceções estão mencionadas nesta publicação. O ideal é considerar código genético padrão e código genético não padrão, como consta nesta matéria.
      - O conhecimento de assuntos relacionados com a biologia molecular (ácidos nucleicos, código genético, síntese proteica, ribozima, inversão do dogma central, mutação gênica, reparo do DNA, RNA antissenso, “splicing”, “splicing” alternativo, projeto genoma humano, técnica do DNA recombinante, clonagem reprodutiva, clonagem terapêutica, geneterapia, “doping” genético, vacinas gênicas, transgênicos, células-tronco, xenotransplante, etc.) tem aumentado bastante nos últimos anos.
      - Atendendo sua solicitação citamos abaixo algumas fontes:
      I. Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts K. & Watson, J. D. Molecular Biology of The Cell. Trhird Edition. Gerland Publishing, Inc. New York e London. (1994), 708-709.
      “… Some Differences Between the Universal Code and Mitochondrial Genetic Codes…”
      II. Lewin, B. Genes V. First published. Oxford University Press. (1994), 174.
      “… Changes in meaning in the principal genome of a species usually concern the termination codons. For example, in a mycoplasma, UGA codes for tryptophan; and in certain species of the ciliates Tetrahymena and Paramecium, UAA and UAG code for glutamine. …”
      III. Watson, J. D., Hopkins, N. H., Roberts, J. W., Steitz, J. A. & Weiner, A. M. Biologie Moléculaire du Gene. Quatrième édition. InterÉdition, Paris (1989), 497-498.
      “…Etant donné ce que nous venons de dire, la découverte que, dans certains organelles sous-cellulaires, le code génétique était em fait légèment différent du code universal…”
      IV. Brown, T. A. Genética – Um Enfoque molecular. 3a edição. Ed. Guanabara Koogan S.A. (1999). 92-94.
      “… o código não é universal …“
      V. Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D. & Darnell, J. Biologia Celular e Molecular. 4ª edição. Livraria e Editora Revinter Ltda. (2002), 335-336.
      “… Os códigos genéticos mitocondriais diferem do código nuclear padrão…”
      VI. Amabis e Martho. Biologia das células. vol.1.pag.252.
      “… O código genético é praticamente o mesmo em todos os seres vivos do planeta e, por isso se diz que ele é universal. As poucas exceções conhecidas são encontradas em mitocôndrias e em genes nucleares de umas poucas espécies, sendo restrita a apenas alguns códon. …”
      Um forte abraço
      Djalma Santos

  11. Professor, estudo bastante através do seu site
    ele é,na minha opinião, o melhor para quem estuda em casa para vestibulares como ENEM,UERJ e outros. Muito obrigado por disponibilizar o conhecimento de maneira tão didática e acessível!
    Grande abraço.

    • Iganbr
      Obrigado pelo comentário. Disponha do nosso blog.
      Um abraço
      Djalma Santos

  12. Na questão 9, a resposta correta não seria letra A invés da C?

    • Prezado Joi
      - Com base no quadro e em seus conhecimentos sobre síntese de proteínas, considere um segmento de DNA que possui a seguinte sequência de bases:
      ACG CGT AAG TTT GTG
      - RNAm formado a partir da sequência de DNA fornecida (transcrição):
      UGC GCA UUC AAA CAC
      - Usando o quadro que indica o código genético, constante na questão, teremos:
      * UGC – cisteína (Cis)
      * GCA – alanina (Ala)
      * UUC – fenilalanina (Fen)
      * AAA – lisina (Lis)
      * CAC – histidina (His)
      - Resposta correta: B
      Um abraço
      Djalma Santos

  13. ola, gostaria de saber o que faz cm que haja especificidade do RNAt com o seu aminoacido…
    obg

    • Cara Zeizy
      - RNA transportador (RNAt): é uma molécula pequena, formada por cerca de 80 a 100 nucleotídeos e representa 10 a 15 de todo o RNA celular. Tem por função transportar os aminoácidos para os ribossomos, em “obediência” à mensagem genética contida no RNAm, que se encontra, no momento da síntese proteica, associado aos ribossomos. Ele atua, em última análise, como moléculas adaptadoras que “lêem” a sequência de nucleotídeos do transcrito de RNAm e a “converte” em uma sequência de aminoácidos. Em função dessa atividade existe, pelo menos, um RNAt para cada aminoácido. Embora seja constituído, como os demais RNA, de uma única cadeia, o RNAt assume a forma espacial de uma folha de trevo (modelo em folha de trevo). Essa estrutura é constituída pelos seguintes componentes: (a) braço aceptor (braço do aminoácido), formado por uma série de geralmente sete pares de bases, apresentando numa extremidade (5′) o nucleotídeo guanina e na outra (3′) a sequência CCA. Durante a síntese proteica, o aminoácido é ligado a esse braço, especificamente na extremidade 3′. (b) braço DHU, assim denominado em função de conter até três resíduos de diidrouracil (pirimidina modificada), dependendo do RNAt. É provável que esse braço esteja relacionado com a aminoacil sintetase (enzima que catalisa a ligação do aminoácido com o RNAt, formando o aminoacil-tRNA). (c) anticódon, desempenha o papel central na decodificação da mensagem genética contida no RNAm. Ele se liga ao códon, sequência de três nucleotídeos presente no RNA mensageiro, durante a tradução da mensagem genética. Dessa forma, um RNAt com anticódon UAC, por exemplo, liga-se ao RNAm somente onde houver o códon AUG. (d) braço opcional, extra ou variável, pode ser uma alça com apenas 3 ou 5 nucleotídeos (caso de cerca de 75% de todos os RNAts) ou uma alça maior, contendo 13 a 21 nucleotídeos. Lembramos que esse braço não está presente em todos os RNAts. (e) braço TpsiC, que contém a ribotimidina (T), não usualmente presentes nos RNAs e pseudouridina (psi), base modificada que possui uma ligação carbono-carbono, não usual nas bases. É provável que esse braço esteja implicado na união do RNAt com a superfície do ribossomo.
      - A especificidade do RNAt está associada, tudo indica, ao braço DHU, como consta no texto acima (“…(b) braço DHU, assim denominado em função de conter até três resíduos de diidrouracil (pirimidina modificada), dependendo do RNAt. É provável que esse braço esteja relacionado com a aminoacil sintetase (enzima que catalisa a ligação do aminoácido com o RNAt, formando o aminoacil-tRNA). …”
      Um abraço
      Djalma Santos


Deixe uma resposta

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair / Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair / Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair / Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair / Alterar )

Conectando a %s

Categorias

Seguir

Obtenha todo post novo entregue na sua caixa de entrada.

Junte-se a 180 outros seguidores

%d blogueiros gostam disto: